Incidental Mutation 'R8061:Prrc2a'
ID 642064
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Name proline-rich coiled-coil 2A
Synonyms 3110039B05Rik, D17H6S51E, Wbp12, G2, Bat2, Bat-2
MMRRC Submission 067497-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R8061 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35368052-35383873 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 35380162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025253] [ENSMUST00000174805]
AlphaFold Q7TSC1
Predicted Effect probably benign
Transcript: ENSMUST00000025253
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174805
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads G A 5: 115,255,710 (GRCm39) R42C probably benign Het
Agrn G A 4: 156,263,411 (GRCm39) R338C probably damaging Het
Anapc1 T C 2: 128,490,408 (GRCm39) E1008G probably damaging Het
Art5 A T 7: 101,747,456 (GRCm39) Y108N possibly damaging Het
As3mt G A 19: 46,728,982 (GRCm39) C369Y probably damaging Het
Asb3 A G 11: 30,948,447 (GRCm39) N41S probably damaging Het
Astn1 G A 1: 158,331,920 (GRCm39) probably null Het
Asxl3 T A 18: 22,657,300 (GRCm39) M1770K possibly damaging Het
Atp8b2 T C 3: 89,853,527 (GRCm39) probably benign Het
Cfap300 A G 9: 8,042,672 (GRCm39) W37R probably damaging Het
Chrm1 T C 19: 8,656,518 (GRCm39) Y408H possibly damaging Het
Chst2 T C 9: 95,287,224 (GRCm39) H374R probably damaging Het
Cnot1 A G 8: 96,491,655 (GRCm39) F390L possibly damaging Het
Comt T C 16: 18,230,040 (GRCm39) Y100C probably benign Het
Cyria G T 12: 12,412,028 (GRCm39) A150S possibly damaging Het
Dclk2 T C 3: 86,720,981 (GRCm39) probably benign Het
Dicer1 G A 12: 104,669,077 (GRCm39) Q1202* probably null Het
Disp1 C T 1: 182,869,151 (GRCm39) V1090M probably damaging Het
Dnajc28 T C 16: 91,414,058 (GRCm39) D62G possibly damaging Het
Dock1 C T 7: 134,374,052 (GRCm39) T566I probably benign Het
Dop1a T G 9: 86,403,246 (GRCm39) M18R possibly damaging Het
Dop1b T C 16: 93,546,884 (GRCm39) L296P probably damaging Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efcab3 A T 11: 104,997,275 (GRCm39) D155V probably benign Het
Ehmt2 T C 17: 35,124,903 (GRCm39) S465P possibly damaging Het
Eno1b G A 18: 48,180,725 (GRCm39) W301* probably null Het
Fpgt A G 3: 154,792,903 (GRCm39) S375P probably benign Het
Gas2l1 G A 11: 5,011,785 (GRCm39) S348F possibly damaging Het
Gen1 A T 12: 11,311,077 (GRCm39) probably benign Het
Ice1 A T 13: 70,751,851 (GRCm39) C1412S probably damaging Het
Iqcn A G 8: 71,161,224 (GRCm39) E139G probably benign Het
Klhl2 A C 8: 65,211,257 (GRCm39) L264V probably damaging Het
Lars2 A G 9: 123,288,562 (GRCm39) T803A probably benign Het
Ldb2 T A 5: 44,637,612 (GRCm39) K232M probably damaging Het
Lix1 G A 17: 17,663,938 (GRCm39) R92Q probably damaging Het
Meig1 C T 2: 3,410,240 (GRCm39) V87I not run Het
Mitf A C 6: 97,970,259 (GRCm39) S176R probably damaging Het
Myh7 A G 14: 55,228,398 (GRCm39) V236A probably benign Het
Myo5a T A 9: 75,030,239 (GRCm39) Y119* probably null Het
Ncapg2 A G 12: 116,390,197 (GRCm39) N382S probably benign Het
Neu2 C T 1: 87,524,633 (GRCm39) P206L probably damaging Het
Or2h2b-ps1 A G 17: 37,480,792 (GRCm39) F147S probably damaging Het
Osbpl5 C T 7: 143,256,461 (GRCm39) R454Q probably benign Het
Panx1 A G 9: 14,956,297 (GRCm39) S13P possibly damaging Het
Pde2a A G 7: 101,153,179 (GRCm39) D413G probably benign Het
Plcb1 A T 2: 135,188,316 (GRCm39) Y803F probably benign Het
Pth2r T A 1: 65,382,660 (GRCm39) Y143N possibly damaging Het
Ptpn4 C T 1: 119,619,330 (GRCm39) probably null Het
Rapgef3 T C 15: 97,659,401 (GRCm39) Y112C probably benign Het
Rusc2 A G 4: 43,422,492 (GRCm39) N907S probably damaging Het
Scn7a T A 2: 66,522,938 (GRCm39) N922I probably damaging Het
Shprh T C 10: 11,088,077 (GRCm39) V1620A possibly damaging Het
Slc25a54 T A 3: 109,018,361 (GRCm39) S280R probably damaging Het
Slc30a5 T C 13: 100,965,419 (GRCm39) I63M probably damaging Het
Smg1 A T 7: 117,751,610 (GRCm39) V2817E unknown Het
Sprr3 T C 3: 92,364,184 (GRCm39) E220G probably damaging Het
Tcf21 T C 10: 22,695,762 (GRCm39) E14G probably benign Het
Tenm4 A G 7: 96,501,663 (GRCm39) D1289G probably damaging Het
Tmem121b C A 6: 120,469,064 (GRCm39) G551V probably damaging Het
Tpk1 A G 6: 43,323,778 (GRCm39) S224P probably damaging Het
Trib1 T C 15: 59,523,404 (GRCm39) I146T probably damaging Het
Ttc32 T A 12: 9,084,953 (GRCm39) Y58N probably damaging Het
Vcan T A 13: 89,805,409 (GRCm39) I3336L probably benign Het
Vmn1r200 C A 13: 22,579,453 (GRCm39) Y85* probably null Het
Vps39 T C 2: 120,174,692 (GRCm39) I97V probably benign Het
Zan T A 5: 137,434,893 (GRCm39) I2167F unknown Het
Zfp37 A T 4: 62,109,665 (GRCm39) Y507* probably null Het
Zfp39 A G 11: 58,793,573 (GRCm39) V55A probably benign Het
Zfp616 A T 11: 73,974,340 (GRCm39) N294I possibly damaging Het
Zfp729a T C 13: 67,768,208 (GRCm39) T674A probably benign Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35,373,959 (GRCm39) missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35,375,177 (GRCm39) missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35,372,080 (GRCm39) missense probably benign 0.00
IGL01618:Prrc2a APN 17 35,368,529 (GRCm39) missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35,369,643 (GRCm39) missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35,374,567 (GRCm39) missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35,379,480 (GRCm39) missense unknown
IGL02683:Prrc2a APN 17 35,374,969 (GRCm39) missense probably benign 0.00
R0145:Prrc2a UTSW 17 35,374,796 (GRCm39) missense probably benign
R0309:Prrc2a UTSW 17 35,369,891 (GRCm39) splice site probably benign
R0441:Prrc2a UTSW 17 35,368,664 (GRCm39) splice site probably benign
R0617:Prrc2a UTSW 17 35,372,536 (GRCm39) missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35,375,308 (GRCm39) missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35,376,863 (GRCm39) missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35,372,888 (GRCm39) splice site probably benign
R1490:Prrc2a UTSW 17 35,372,230 (GRCm39) missense probably benign
R1643:Prrc2a UTSW 17 35,375,930 (GRCm39) missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35,369,683 (GRCm39) missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35,372,284 (GRCm39) missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35,376,884 (GRCm39) missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35,376,405 (GRCm39) missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35,380,044 (GRCm39) missense unknown
R2270:Prrc2a UTSW 17 35,368,512 (GRCm39) missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35,376,474 (GRCm39) missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35,376,908 (GRCm39) missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35,377,473 (GRCm39) missense unknown
R4655:Prrc2a UTSW 17 35,374,590 (GRCm39) missense probably benign 0.00
R4792:Prrc2a UTSW 17 35,375,463 (GRCm39) missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35,369,018 (GRCm39) missense probably damaging 1.00
R4798:Prrc2a UTSW 17 35,369,018 (GRCm39) missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35,369,018 (GRCm39) missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35,368,974 (GRCm39) missense probably benign 0.11
R5129:Prrc2a UTSW 17 35,379,154 (GRCm39) missense unknown
R5155:Prrc2a UTSW 17 35,379,067 (GRCm39) splice site probably null
R5210:Prrc2a UTSW 17 35,372,596 (GRCm39) missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35,380,023 (GRCm39) missense unknown
R5474:Prrc2a UTSW 17 35,378,189 (GRCm39) missense unknown
R5775:Prrc2a UTSW 17 35,377,463 (GRCm39) missense unknown
R5934:Prrc2a UTSW 17 35,369,060 (GRCm39) missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35,371,716 (GRCm39) missense probably benign 0.00
R6291:Prrc2a UTSW 17 35,373,909 (GRCm39) missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35,381,241 (GRCm39) missense unknown
R6622:Prrc2a UTSW 17 35,374,396 (GRCm39) missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35,374,651 (GRCm39) missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35,378,477 (GRCm39) splice site probably null
R7026:Prrc2a UTSW 17 35,380,803 (GRCm39) missense unknown
R7059:Prrc2a UTSW 17 35,376,364 (GRCm39) missense probably damaging 0.99
R7489:Prrc2a UTSW 17 35,381,330 (GRCm39) missense unknown
R7502:Prrc2a UTSW 17 35,381,286 (GRCm39) missense unknown
R7951:Prrc2a UTSW 17 35,379,477 (GRCm39) missense unknown
R8324:Prrc2a UTSW 17 35,375,960 (GRCm39) missense possibly damaging 0.46
R8705:Prrc2a UTSW 17 35,372,542 (GRCm39) missense possibly damaging 0.92
R9016:Prrc2a UTSW 17 35,378,844 (GRCm39) missense unknown
R9310:Prrc2a UTSW 17 35,374,975 (GRCm39) missense probably benign 0.38
R9376:Prrc2a UTSW 17 35,369,598 (GRCm39) missense possibly damaging 0.85
R9645:Prrc2a UTSW 17 35,381,176 (GRCm39) critical splice donor site probably null
R9703:Prrc2a UTSW 17 35,378,320 (GRCm39) missense unknown
X0011:Prrc2a UTSW 17 35,374,874 (GRCm39) missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35,380,336 (GRCm39) missense unknown
Z1177:Prrc2a UTSW 17 35,374,676 (GRCm39) missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35,373,791 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAGTGCACCACTTCAAGC -3'
(R):5'- GAGAGGAATTTCCGACCCTG -3'

Sequencing Primer
(F):5'- GTGCACCACTTCAAGCAACAC -3'
(R):5'- AATTTCCGACCCTGCAGGC -3'
Posted On 2020-07-30