Incidental Mutation 'BB001:Pla2g4d'
ID 642071
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # BB001
Quality Score 104.008
Status Not validated
Chromosome 2
Chromosomal Location 120096347-120119678 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) T to C at 120119645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably benign
Transcript: ENSMUST00000094665
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120,112,207 (GRCm39) missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120,097,304 (GRCm39) missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120,111,117 (GRCm39) missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120,105,768 (GRCm39) missense possibly damaging 0.91
R0962:Pla2g4d UTSW 2 120,111,098 (GRCm39) critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120,099,384 (GRCm39) missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120,114,648 (GRCm39) missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120,100,631 (GRCm39) splice site probably benign
R1680:Pla2g4d UTSW 2 120,108,231 (GRCm39) critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120,107,971 (GRCm39) missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120,101,622 (GRCm39) missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120,112,108 (GRCm39) splice site probably benign
R3122:Pla2g4d UTSW 2 120,109,384 (GRCm39) missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120,114,644 (GRCm39) missense probably benign
R4737:Pla2g4d UTSW 2 120,097,271 (GRCm39) missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120,097,224 (GRCm39) missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120,112,176 (GRCm39) nonsense probably null
R5530:Pla2g4d UTSW 2 120,100,036 (GRCm39) missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120,109,429 (GRCm39) missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120,100,045 (GRCm39) missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120,101,114 (GRCm39) missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120,100,830 (GRCm39) missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120,114,617 (GRCm39) missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120,109,459 (GRCm39) missense probably benign
R7552:Pla2g4d UTSW 2 120,114,620 (GRCm39) missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120,119,457 (GRCm39) missense probably benign
R7692:Pla2g4d UTSW 2 120,109,776 (GRCm39) missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120,097,211 (GRCm39) missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R7972:Pla2g4d UTSW 2 120,109,413 (GRCm39) missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120,107,980 (GRCm39) missense probably null 1.00
R8737:Pla2g4d UTSW 2 120,100,466 (GRCm39) missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120,099,248 (GRCm39) critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120,100,442 (GRCm39) missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120,100,453 (GRCm39) missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120,099,378 (GRCm39) missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120,112,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGACACTGTTACCTGG -3'
(R):5'- GGTATTGACCTACAAGGGTTTCCTC -3'

Sequencing Primer
(F):5'- AAGGATGGCCATGTAGTCTCTC -3'
(R):5'- GACCTACAAGGGTTTCCTCTTTGTTG -3'
Posted On 2020-08-01