Incidental Mutation 'BB001:Pla2g4d'
ID642071
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Namephospholipase A2, group IVD
SynonymsPla2delta, 2610311B01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #BB001
Quality Score104.008
Status Not validated
Chromosome2
Chromosomal Location120265595-120289197 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 120289164 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
Predicted Effect probably benign
Transcript: ENSMUST00000094665
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gcnt2 A T 13: 40,918,564 K228* probably null Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120277499 missense probably null 1.00
R8737:Pla2g4d UTSW 2 120269985 missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120268767 critical splice donor site probably null
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGACACTGTTACCTGG -3'
(R):5'- GGTATTGACCTACAAGGGTTTCCTC -3'

Sequencing Primer
(F):5'- AAGGATGGCCATGTAGTCTCTC -3'
(R):5'- GACCTACAAGGGTTTCCTCTTTGTTG -3'
Posted On2020-08-01