Incidental Mutation 'BB001:Ctcfl'
ID 642075
Institutional Source Beutler Lab
Gene Symbol Ctcfl
Ensembl Gene ENSMUSG00000070495
Gene Name CCCTC-binding factor like
Synonyms Boris, OTTMUSG00000016680
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.284) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 172935402-172961318 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 172955449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 271 (T271I)
Ref Sequence ENSEMBL: ENSMUSP00000091845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]
AlphaFold A2APF3
Predicted Effect possibly damaging
Transcript: ENSMUST00000094287
AA Change: T271I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: T271I

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179693
AA Change: T271I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: T271I

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Ctcfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ctcfl APN 2 172,936,527 (GRCm39) missense possibly damaging 0.82
IGL01418:Ctcfl APN 2 172,960,124 (GRCm39) missense probably benign 0.03
IGL01524:Ctcfl APN 2 172,959,177 (GRCm39) missense probably benign 0.08
IGL02610:Ctcfl APN 2 172,947,819 (GRCm39) splice site probably benign
IGL02961:Ctcfl APN 2 172,943,712 (GRCm39) missense possibly damaging 0.70
BB011:Ctcfl UTSW 2 172,955,449 (GRCm39) missense possibly damaging 0.71
R0147:Ctcfl UTSW 2 172,960,340 (GRCm39) missense possibly damaging 0.75
R0148:Ctcfl UTSW 2 172,960,340 (GRCm39) missense possibly damaging 0.75
R0362:Ctcfl UTSW 2 172,960,236 (GRCm39) missense probably damaging 0.99
R1099:Ctcfl UTSW 2 172,954,153 (GRCm39) missense probably damaging 1.00
R1540:Ctcfl UTSW 2 172,954,141 (GRCm39) missense probably benign 0.36
R1892:Ctcfl UTSW 2 172,960,478 (GRCm39) missense probably benign 0.24
R2036:Ctcfl UTSW 2 172,943,778 (GRCm39) missense possibly damaging 0.95
R2060:Ctcfl UTSW 2 172,960,299 (GRCm39) missense probably benign 0.00
R2925:Ctcfl UTSW 2 172,936,489 (GRCm39) missense probably damaging 1.00
R4327:Ctcfl UTSW 2 172,955,299 (GRCm39) intron probably benign
R4837:Ctcfl UTSW 2 172,955,449 (GRCm39) missense probably benign 0.00
R4894:Ctcfl UTSW 2 172,959,196 (GRCm39) missense probably benign 0.19
R4909:Ctcfl UTSW 2 172,937,191 (GRCm39) missense probably benign 0.42
R5128:Ctcfl UTSW 2 172,959,189 (GRCm39) missense probably benign 0.00
R5247:Ctcfl UTSW 2 172,955,402 (GRCm39) missense probably damaging 1.00
R6263:Ctcfl UTSW 2 172,937,130 (GRCm39) missense probably benign 0.00
R6768:Ctcfl UTSW 2 172,959,084 (GRCm39) missense possibly damaging 0.84
R7045:Ctcfl UTSW 2 172,954,167 (GRCm39) missense probably damaging 1.00
R7180:Ctcfl UTSW 2 172,947,770 (GRCm39) splice site probably null
R7256:Ctcfl UTSW 2 172,960,268 (GRCm39) missense probably benign 0.01
R7268:Ctcfl UTSW 2 172,949,588 (GRCm39) missense probably benign 0.26
R7378:Ctcfl UTSW 2 172,954,051 (GRCm39) missense probably damaging 1.00
R7560:Ctcfl UTSW 2 172,960,199 (GRCm39) missense probably damaging 0.96
R7657:Ctcfl UTSW 2 172,955,449 (GRCm39) missense possibly damaging 0.71
R7733:Ctcfl UTSW 2 172,958,985 (GRCm39) missense probably benign
R7924:Ctcfl UTSW 2 172,955,449 (GRCm39) missense possibly damaging 0.71
R7945:Ctcfl UTSW 2 172,960,451 (GRCm39) missense probably benign
R8022:Ctcfl UTSW 2 172,960,559 (GRCm39) missense probably benign 0.15
R8038:Ctcfl UTSW 2 172,943,698 (GRCm39) missense probably damaging 1.00
R8911:Ctcfl UTSW 2 172,937,121 (GRCm39) critical splice donor site probably null
R9031:Ctcfl UTSW 2 172,959,044 (GRCm39) missense probably benign 0.07
R9358:Ctcfl UTSW 2 172,960,581 (GRCm39) start codon destroyed possibly damaging 0.81
R9401:Ctcfl UTSW 2 172,947,881 (GRCm39) missense probably damaging 0.99
R9490:Ctcfl UTSW 2 172,960,548 (GRCm39) missense probably benign 0.00
Z1088:Ctcfl UTSW 2 172,960,137 (GRCm39) missense probably benign 0.01
Z1177:Ctcfl UTSW 2 172,943,829 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCTCCAGACAGTGAAGCC -3'
(R):5'- TCCCGAGGTTTTGAGACATCTC -3'

Sequencing Primer
(F):5'- ACAGTGAAGCCCCAGGTG -3'
(R):5'- GAGACATCTCATAATCCTCAACAGC -3'
Posted On 2020-08-01