Incidental Mutation 'BB001:Rasef'
ID 642078
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 73632816-73709231 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73659166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect probably null
Transcript: ENSMUST00000058292
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102837
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222414
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73,689,662 (GRCm39) nonsense probably null
IGL01329:Rasef APN 4 73,645,882 (GRCm39) missense probably damaging 1.00
IGL01517:Rasef APN 4 73,688,059 (GRCm39) missense probably benign 0.03
IGL02465:Rasef APN 4 73,652,725 (GRCm39) missense probably damaging 1.00
IGL02676:Rasef APN 4 73,677,966 (GRCm39) missense possibly damaging 0.69
IGL03137:Rasef APN 4 73,652,720 (GRCm39) nonsense probably null
IGL03403:Rasef APN 4 73,652,771 (GRCm39) missense probably damaging 1.00
BB011:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
P0033:Rasef UTSW 4 73,668,089 (GRCm39) missense probably benign 0.26
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0317:Rasef UTSW 4 73,666,799 (GRCm39) missense probably damaging 1.00
R0686:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R0987:Rasef UTSW 4 73,652,721 (GRCm39) nonsense probably null
R1115:Rasef UTSW 4 73,666,841 (GRCm39) missense possibly damaging 0.85
R1511:Rasef UTSW 4 73,653,985 (GRCm39) missense probably damaging 1.00
R1585:Rasef UTSW 4 73,658,574 (GRCm39) missense probably damaging 1.00
R1646:Rasef UTSW 4 73,652,786 (GRCm39) missense probably damaging 1.00
R1705:Rasef UTSW 4 73,662,301 (GRCm39) nonsense probably null
R1918:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R1919:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R3819:Rasef UTSW 4 73,677,942 (GRCm39) missense probably damaging 1.00
R3891:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R3892:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R4344:Rasef UTSW 4 73,663,326 (GRCm39) missense probably damaging 1.00
R4491:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4492:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4594:Rasef UTSW 4 73,698,626 (GRCm39) missense possibly damaging 0.47
R4915:Rasef UTSW 4 73,649,696 (GRCm39) missense probably damaging 1.00
R5276:Rasef UTSW 4 73,654,004 (GRCm39) missense probably null 1.00
R5359:Rasef UTSW 4 73,689,565 (GRCm39) missense probably damaging 1.00
R5682:Rasef UTSW 4 73,659,208 (GRCm39) nonsense probably null
R5693:Rasef UTSW 4 73,688,076 (GRCm39) missense probably damaging 0.99
R6414:Rasef UTSW 4 73,658,818 (GRCm39) missense probably benign 0.13
R6543:Rasef UTSW 4 73,698,756 (GRCm39) intron probably benign
R6593:Rasef UTSW 4 73,663,327 (GRCm39) missense probably damaging 1.00
R7078:Rasef UTSW 4 73,698,626 (GRCm39) missense probably benign 0.01
R7083:Rasef UTSW 4 73,709,221 (GRCm39) missense probably benign 0.26
R7106:Rasef UTSW 4 73,645,864 (GRCm39) missense probably damaging 1.00
R7127:Rasef UTSW 4 73,662,369 (GRCm39) missense probably damaging 1.00
R7329:Rasef UTSW 4 73,662,374 (GRCm39) missense probably damaging 1.00
R7767:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R7891:Rasef UTSW 4 73,709,201 (GRCm39) missense probably benign
R7891:Rasef UTSW 4 73,677,935 (GRCm39) missense probably benign 0.00
R7924:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
R7997:Rasef UTSW 4 73,658,799 (GRCm39) missense possibly damaging 0.78
R8554:Rasef UTSW 4 73,645,844 (GRCm39) missense probably benign 0.03
R8832:Rasef UTSW 4 73,698,558 (GRCm39) intron probably benign
R8850:Rasef UTSW 4 73,645,840 (GRCm39) missense probably damaging 1.00
R8985:Rasef UTSW 4 73,708,960 (GRCm39) missense possibly damaging 0.48
R9093:Rasef UTSW 4 73,698,583 (GRCm39) missense probably benign 0.00
R9179:Rasef UTSW 4 73,662,356 (GRCm39) missense probably damaging 0.97
R9199:Rasef UTSW 4 73,658,625 (GRCm39) missense possibly damaging 0.88
R9300:Rasef UTSW 4 73,659,393 (GRCm39) missense probably benign
R9310:Rasef UTSW 4 73,653,956 (GRCm39) critical splice donor site probably null
R9415:Rasef UTSW 4 73,645,882 (GRCm39) missense probably benign 0.00
R9482:Rasef UTSW 4 73,708,933 (GRCm39) missense probably benign 0.00
R9719:Rasef UTSW 4 73,688,102 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTGAGTGTACTGCCAGTGTG -3'
(R):5'- CTGTGACCCTCTGCAGAAGATG -3'

Sequencing Primer
(F):5'- GTGTGGTTACTAAGCAGACTCCC -3'
(R):5'- GAATTATGAAGTTGACAGCCTGCC -3'
Posted On 2020-08-01