Incidental Mutation 'BB001:Ubr4'
ID 642080
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Name ubiquitin protein ligase E3 component n-recognin 4
Synonyms p600, A930005E13Rik, LOC381562, D930005K06Rik, Zubr1, 1810009A16Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139107970-139216844 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 139194587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 1160 (L1160R)
Ref Sequence ENSEMBL: ENSMUSP00000117419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000097822
AA Change: L4319R
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: L4319R

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147999
AA Change: L1160R
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036
AA Change: L1160R

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165860
AA Change: L4295R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: L4295R

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139,192,633 (GRCm39) missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139,155,877 (GRCm39) missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139,182,495 (GRCm39) missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139,148,556 (GRCm39) missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139,168,077 (GRCm39) missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139,203,593 (GRCm39) missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139,120,470 (GRCm39) critical splice donor site probably null
IGL01126:Ubr4 APN 4 139,129,866 (GRCm39) missense probably benign 0.04
IGL01311:Ubr4 APN 4 139,206,356 (GRCm39) missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139,208,039 (GRCm39) missense unknown
IGL01388:Ubr4 APN 4 139,187,554 (GRCm39) missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139,138,111 (GRCm39) missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139,165,351 (GRCm39) splice site probably benign
IGL01449:Ubr4 APN 4 139,140,047 (GRCm39) missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139,170,140 (GRCm39) splice site probably benign
IGL01568:Ubr4 APN 4 139,148,684 (GRCm39) missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139,189,845 (GRCm39) splice site probably benign
IGL01621:Ubr4 APN 4 139,168,094 (GRCm39) nonsense probably null
IGL01639:Ubr4 APN 4 139,144,655 (GRCm39) missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139,135,107 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139,145,772 (GRCm39) missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139,199,811 (GRCm39) missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139,204,469 (GRCm39) missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139,139,989 (GRCm39) nonsense probably null
IGL01874:Ubr4 APN 4 139,120,600 (GRCm39) splice site probably benign
IGL01889:Ubr4 APN 4 139,189,783 (GRCm39) nonsense probably null
IGL01891:Ubr4 APN 4 139,163,571 (GRCm39) critical splice donor site probably null
IGL01980:Ubr4 APN 4 139,156,913 (GRCm39) missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139,180,052 (GRCm39) critical splice donor site probably null
IGL02153:Ubr4 APN 4 139,187,471 (GRCm39) nonsense probably null
IGL02173:Ubr4 APN 4 139,164,381 (GRCm39) splice site probably null
IGL02214:Ubr4 APN 4 139,155,894 (GRCm39) missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139,189,138 (GRCm39) critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139,115,746 (GRCm39) missense probably benign 0.01
IGL02246:Ubr4 APN 4 139,186,414 (GRCm39) missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139,182,939 (GRCm39) nonsense probably null
IGL02273:Ubr4 APN 4 139,199,889 (GRCm39) missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139,200,489 (GRCm39) missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139,206,233 (GRCm39) missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139,148,560 (GRCm39) nonsense probably null
IGL02477:Ubr4 APN 4 139,163,516 (GRCm39) missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139,142,429 (GRCm39) missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139,194,561 (GRCm39) nonsense probably null
IGL02679:Ubr4 APN 4 139,186,445 (GRCm39) missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139,196,122 (GRCm39) missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139,138,095 (GRCm39) missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139,120,470 (GRCm39) critical splice donor site probably null
IGL02892:Ubr4 APN 4 139,144,642 (GRCm39) missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139,199,819 (GRCm39) missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139,152,606 (GRCm39) missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139,135,131 (GRCm39) missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139,207,987 (GRCm39) missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139,137,041 (GRCm39) missense probably benign 0.02
IGL03087:Ubr4 APN 4 139,177,668 (GRCm39) nonsense probably null
IGL03116:Ubr4 APN 4 139,206,892 (GRCm39) splice site probably benign
IGL03212:Ubr4 APN 4 139,137,074 (GRCm39) missense probably benign 0.13
IGL03228:Ubr4 APN 4 139,156,909 (GRCm39) missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139,167,746 (GRCm39) missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139,142,343 (GRCm39) missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139,179,989 (GRCm39) missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139,127,240 (GRCm39) nonsense probably null
Aqua_regia UTSW 4 139,180,030 (GRCm39) nonsense probably null
Eats UTSW 4 139,190,886 (GRCm39) missense probably damaging 0.97
Hardened UTSW 4 139,196,158 (GRCm39) missense probably damaging 1.00
Stoney UTSW 4 139,171,998 (GRCm39) missense probably damaging 1.00
Uber UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
BB011:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
P0019:Ubr4 UTSW 4 139,179,092 (GRCm39) missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139,129,871 (GRCm39) missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139,179,099 (GRCm39) missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139,118,211 (GRCm39) missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0006:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0008:Ubr4 UTSW 4 139,157,487 (GRCm39) missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139,127,704 (GRCm39) missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139,127,704 (GRCm39) missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139,154,104 (GRCm39) missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139,164,369 (GRCm39) splice site probably benign
R0044:Ubr4 UTSW 4 139,164,369 (GRCm39) splice site probably benign
R0088:Ubr4 UTSW 4 139,168,125 (GRCm39) missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139,191,362 (GRCm39) missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139,172,573 (GRCm39) missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139,157,568 (GRCm39) missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0270:Ubr4 UTSW 4 139,206,746 (GRCm39) splice site probably benign
R0285:Ubr4 UTSW 4 139,168,112 (GRCm39) missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139,149,729 (GRCm39) missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139,119,171 (GRCm39) missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139,138,171 (GRCm39) splice site probably benign
R0450:Ubr4 UTSW 4 139,157,534 (GRCm39) missense probably benign 0.14
R0504:Ubr4 UTSW 4 139,133,889 (GRCm39) missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139,208,149 (GRCm39) critical splice donor site probably null
R0510:Ubr4 UTSW 4 139,157,534 (GRCm39) missense probably benign 0.14
R0513:Ubr4 UTSW 4 139,144,186 (GRCm39) missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139,119,435 (GRCm39) missense probably benign 0.00
R0558:Ubr4 UTSW 4 139,154,213 (GRCm39) missense probably benign 0.09
R0617:Ubr4 UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
R0636:Ubr4 UTSW 4 139,163,613 (GRCm39) splice site probably null
R0637:Ubr4 UTSW 4 139,126,926 (GRCm39) missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139,128,637 (GRCm39) missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139,151,217 (GRCm39) missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139,212,631 (GRCm39) missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139,155,339 (GRCm39) splice site probably null
R0751:Ubr4 UTSW 4 139,164,509 (GRCm39) splice site probably benign
R0789:Ubr4 UTSW 4 139,137,582 (GRCm39) critical splice donor site probably null
R0825:Ubr4 UTSW 4 139,206,887 (GRCm39) critical splice donor site probably null
R0828:Ubr4 UTSW 4 139,177,864 (GRCm39) splice site probably benign
R1052:Ubr4 UTSW 4 139,182,771 (GRCm39) missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139,164,509 (GRCm39) splice site probably benign
R1222:Ubr4 UTSW 4 139,115,782 (GRCm39) splice site probably null
R1258:Ubr4 UTSW 4 139,154,225 (GRCm39) missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139,187,434 (GRCm39) missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139,129,923 (GRCm39) missense probably benign 0.00
R1450:Ubr4 UTSW 4 139,195,339 (GRCm39) missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139,148,537 (GRCm39) splice site probably null
R1470:Ubr4 UTSW 4 139,148,537 (GRCm39) splice site probably null
R1474:Ubr4 UTSW 4 139,156,890 (GRCm39) missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139,153,151 (GRCm39) missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139,155,462 (GRCm39) missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139,144,238 (GRCm39) nonsense probably null
R1785:Ubr4 UTSW 4 139,151,256 (GRCm39) missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139,151,256 (GRCm39) missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139,120,364 (GRCm39) missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139,155,907 (GRCm39) missense probably benign 0.25
R1800:Ubr4 UTSW 4 139,135,274 (GRCm39) missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139,179,874 (GRCm39) splice site probably null
R1827:Ubr4 UTSW 4 139,153,008 (GRCm39) critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139,182,871 (GRCm39) missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139,178,555 (GRCm39) critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139,207,963 (GRCm39) missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139,206,851 (GRCm39) missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139,156,922 (GRCm39) nonsense probably null
R2140:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139,137,960 (GRCm39) missense probably benign 0.25
R2237:Ubr4 UTSW 4 139,170,101 (GRCm39) missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139,176,232 (GRCm39) missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139,140,773 (GRCm39) missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139,147,684 (GRCm39) splice site probably benign
R2353:Ubr4 UTSW 4 139,160,984 (GRCm39) missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139,200,853 (GRCm39) missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139,200,516 (GRCm39) unclassified probably benign
R2896:Ubr4 UTSW 4 139,182,955 (GRCm39) splice site probably null
R2922:Ubr4 UTSW 4 139,206,811 (GRCm39) missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139,133,847 (GRCm39) missense probably benign 0.22
R2973:Ubr4 UTSW 4 139,133,847 (GRCm39) missense probably benign 0.22
R2989:Ubr4 UTSW 4 139,190,869 (GRCm39) missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139,149,166 (GRCm39) missense probably benign 0.03
R3276:Ubr4 UTSW 4 139,149,166 (GRCm39) missense probably benign 0.03
R3772:Ubr4 UTSW 4 139,180,011 (GRCm39) missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139,186,437 (GRCm39) missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139,151,301 (GRCm39) missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
R3951:Ubr4 UTSW 4 139,120,405 (GRCm39) missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139,179,116 (GRCm39) missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139,120,725 (GRCm39) missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139,199,820 (GRCm39) missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139,137,751 (GRCm39) missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139,189,167 (GRCm39) missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139,189,167 (GRCm39) missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139,145,813 (GRCm39) missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139,108,164 (GRCm39) missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139,126,890 (GRCm39) missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139,133,829 (GRCm39) missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139,163,502 (GRCm39) missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139,138,027 (GRCm39) missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139,138,027 (GRCm39) missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139,135,983 (GRCm39) missense probably benign 0.09
R4701:Ubr4 UTSW 4 139,198,647 (GRCm39) missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139,177,840 (GRCm39) missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139,209,890 (GRCm39) missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139,151,190 (GRCm39) missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139,149,044 (GRCm39) missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139,129,857 (GRCm39) missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139,155,828 (GRCm39) missense probably benign 0.14
R4936:Ubr4 UTSW 4 139,123,877 (GRCm39) missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139,163,480 (GRCm39) missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139,137,934 (GRCm39) missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139,137,960 (GRCm39) missense probably benign 0.25
R5197:Ubr4 UTSW 4 139,195,408 (GRCm39) missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139,129,877 (GRCm39) nonsense probably null
R5219:Ubr4 UTSW 4 139,204,543 (GRCm39) nonsense probably null
R5346:Ubr4 UTSW 4 139,155,802 (GRCm39) missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139,124,839 (GRCm39) intron probably benign
R5442:Ubr4 UTSW 4 139,135,083 (GRCm39) missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139,208,099 (GRCm39) missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139,187,401 (GRCm39) missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139,119,349 (GRCm39) missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139,179,959 (GRCm39) missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139,171,998 (GRCm39) missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139,155,894 (GRCm39) missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139,187,406 (GRCm39) missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139,195,407 (GRCm39) missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139,152,529 (GRCm39) missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139,196,158 (GRCm39) missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139,152,641 (GRCm39) missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139,135,937 (GRCm39) nonsense probably null
R5901:Ubr4 UTSW 4 139,178,565 (GRCm39) missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139,182,949 (GRCm39) missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139,148,389 (GRCm39) splice site probably null
R6065:Ubr4 UTSW 4 139,148,549 (GRCm39) missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139,144,675 (GRCm39) missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139,148,559 (GRCm39) missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139,179,951 (GRCm39) missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139,136,200 (GRCm39) missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139,156,850 (GRCm39) missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139,156,949 (GRCm39) missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139,124,525 (GRCm39) critical splice donor site probably null
R6481:Ubr4 UTSW 4 139,159,062 (GRCm39) missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139,171,982 (GRCm39) missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139,141,705 (GRCm39) missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139,182,897 (GRCm39) missense probably benign 0.17
R6648:Ubr4 UTSW 4 139,180,030 (GRCm39) nonsense probably null
R6649:Ubr4 UTSW 4 139,200,935 (GRCm39) missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139,200,935 (GRCm39) missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139,192,652 (GRCm39) missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139,216,493 (GRCm39) missense unknown
R6772:Ubr4 UTSW 4 139,194,541 (GRCm39) nonsense probably null
R6857:Ubr4 UTSW 4 139,213,362 (GRCm39) missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139,194,538 (GRCm39) missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139,185,545 (GRCm39) critical splice donor site probably null
R6943:Ubr4 UTSW 4 139,164,442 (GRCm39) nonsense probably null
R6970:Ubr4 UTSW 4 139,133,839 (GRCm39) nonsense probably null
R6976:Ubr4 UTSW 4 139,120,388 (GRCm39) missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139,141,715 (GRCm39) missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139,120,401 (GRCm39) missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139,177,824 (GRCm39) missense
R7222:Ubr4 UTSW 4 139,190,684 (GRCm39) missense unknown
R7241:Ubr4 UTSW 4 139,170,725 (GRCm39) missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139,140,749 (GRCm39) missense probably benign 0.09
R7367:Ubr4 UTSW 4 139,180,002 (GRCm39) missense unknown
R7393:Ubr4 UTSW 4 139,154,096 (GRCm39) missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139,115,693 (GRCm39) missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139,189,778 (GRCm39) missense unknown
R7502:Ubr4 UTSW 4 139,139,983 (GRCm39) missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139,179,966 (GRCm39) missense unknown
R7526:Ubr4 UTSW 4 139,149,728 (GRCm39) missense probably benign 0.00
R7529:Ubr4 UTSW 4 139,149,728 (GRCm39) missense probably benign 0.00
R7666:Ubr4 UTSW 4 139,140,791 (GRCm39) missense possibly damaging 0.81
R7699:Ubr4 UTSW 4 139,136,178 (GRCm39) nonsense probably null
R7700:Ubr4 UTSW 4 139,136,178 (GRCm39) nonsense probably null
R7726:Ubr4 UTSW 4 139,186,231 (GRCm39) missense unknown
R7753:Ubr4 UTSW 4 139,197,603 (GRCm39) missense unknown
R7810:Ubr4 UTSW 4 139,142,394 (GRCm39) missense
R7837:Ubr4 UTSW 4 139,120,462 (GRCm39) nonsense probably null
R7868:Ubr4 UTSW 4 139,187,344 (GRCm39) missense unknown
R7872:Ubr4 UTSW 4 139,120,373 (GRCm39) missense possibly damaging 0.94
R7887:Ubr4 UTSW 4 139,135,121 (GRCm39) missense probably damaging 0.99
R7924:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
R7980:Ubr4 UTSW 4 139,145,717 (GRCm39) missense
R7982:Ubr4 UTSW 4 139,155,519 (GRCm39) critical splice donor site probably null
R8005:Ubr4 UTSW 4 139,139,941 (GRCm39) missense probably damaging 0.98
R8054:Ubr4 UTSW 4 139,195,413 (GRCm39) missense unknown
R8094:Ubr4 UTSW 4 139,168,007 (GRCm39) missense probably damaging 0.97
R8151:Ubr4 UTSW 4 139,130,112 (GRCm39) missense probably damaging 0.97
R8183:Ubr4 UTSW 4 139,209,782 (GRCm39) missense unknown
R8252:Ubr4 UTSW 4 139,200,528 (GRCm39) missense unknown
R8505:Ubr4 UTSW 4 139,156,880 (GRCm39) missense
R8519:Ubr4 UTSW 4 139,143,958 (GRCm39) missense probably damaging 0.97
R8716:Ubr4 UTSW 4 139,196,164 (GRCm39) missense unknown
R8720:Ubr4 UTSW 4 139,208,149 (GRCm39) critical splice donor site probably null
R8749:Ubr4 UTSW 4 139,129,935 (GRCm39) missense probably damaging 0.98
R8768:Ubr4 UTSW 4 139,149,076 (GRCm39) missense
R8789:Ubr4 UTSW 4 139,137,494 (GRCm39) missense possibly damaging 0.76
R8879:Ubr4 UTSW 4 139,137,829 (GRCm39) missense probably benign 0.06
R8937:Ubr4 UTSW 4 139,190,886 (GRCm39) missense probably damaging 0.97
R9006:Ubr4 UTSW 4 139,172,003 (GRCm39) critical splice donor site probably null
R9116:Ubr4 UTSW 4 139,145,785 (GRCm39) missense
R9134:Ubr4 UTSW 4 139,127,755 (GRCm39) critical splice donor site probably null
R9251:Ubr4 UTSW 4 139,177,636 (GRCm39) missense
R9340:Ubr4 UTSW 4 139,182,763 (GRCm39) missense unknown
R9384:Ubr4 UTSW 4 139,194,631 (GRCm39) missense unknown
R9389:Ubr4 UTSW 4 139,153,235 (GRCm39) missense
R9393:Ubr4 UTSW 4 139,212,613 (GRCm39) missense unknown
R9531:Ubr4 UTSW 4 139,135,217 (GRCm39) missense probably benign 0.00
R9573:Ubr4 UTSW 4 139,148,450 (GRCm39) missense
R9604:Ubr4 UTSW 4 139,159,827 (GRCm39) critical splice donor site probably null
R9613:Ubr4 UTSW 4 139,149,073 (GRCm39) missense
R9623:Ubr4 UTSW 4 139,159,024 (GRCm39) missense probably benign 0.00
R9651:Ubr4 UTSW 4 139,206,859 (GRCm39) missense unknown
R9685:Ubr4 UTSW 4 139,191,341 (GRCm39) missense unknown
R9698:Ubr4 UTSW 4 139,167,975 (GRCm39) missense
R9700:Ubr4 UTSW 4 139,119,388 (GRCm39) missense probably damaging 0.97
R9727:Ubr4 UTSW 4 139,140,735 (GRCm39) missense probably damaging 0.98
R9766:Ubr4 UTSW 4 139,194,595 (GRCm39) missense unknown
T0975:Ubr4 UTSW 4 139,179,092 (GRCm39) missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139,137,582 (GRCm39) critical splice donor site probably null
Z1176:Ubr4 UTSW 4 139,137,456 (GRCm39) missense probably damaging 1.00
Z1176:Ubr4 UTSW 4 139,129,971 (GRCm39) missense probably benign 0.04
Z1176:Ubr4 UTSW 4 139,127,696 (GRCm39) missense probably damaging 1.00
Z1177:Ubr4 UTSW 4 139,177,792 (GRCm39) missense
Z1186:Ubr4 UTSW 4 139,137,964 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTGCTCCCAGAGAAAGCAGAG -3'
(R):5'- GGAAGCTGCACCTACTCTTTG -3'

Sequencing Primer
(F):5'- AGAGCAAGCGCGTGGTTTG -3'
(R):5'- ACTCTTTGTCAGTGGACCTG -3'
Posted On 2020-08-01