Incidental Mutation 'BB001:Cnot1'
ID 642103
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB001
Quality Score 149.467
Status Not validated
Chromosome 8
Chromosomal Location 96446079-96534092 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) ACG to A at 96472275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000068452
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098473
AA Change: 1188
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: 1188

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211887
Predicted Effect probably null
Transcript: ENSMUST00000211973
Predicted Effect probably null
Transcript: ENSMUST00000213006
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 96,452,707 (GRCm39) missense probably damaging 1.00
IGL01340:Cnot1 APN 8 96,487,165 (GRCm39) missense probably damaging 1.00
IGL01457:Cnot1 APN 8 96,467,637 (GRCm39) missense probably damaging 1.00
IGL01505:Cnot1 APN 8 96,455,346 (GRCm39) missense probably damaging 0.98
IGL02401:Cnot1 APN 8 96,482,761 (GRCm39) missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 96,500,113 (GRCm39) missense probably damaging 1.00
IGL02696:Cnot1 APN 8 96,471,645 (GRCm39) missense probably benign 0.00
IGL02754:Cnot1 APN 8 96,481,706 (GRCm39) missense probably benign 0.03
IGL03092:Cnot1 APN 8 96,496,243 (GRCm39) intron probably benign
IGL03174:Cnot1 APN 8 96,487,983 (GRCm39) missense probably damaging 1.00
IGL03310:Cnot1 APN 8 96,462,308 (GRCm39) splice site probably benign
IGL03371:Cnot1 APN 8 96,501,344 (GRCm39) missense possibly damaging 0.85
Affiliate UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
Barge UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
Byproduct UTSW 8 96,472,275 (GRCm39) frame shift probably null
Chairman UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
cohort UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
Director UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
kowloon UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
Quorum UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
tugboat UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
Xiao UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
BB003:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB011:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB013:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0091:Cnot1 UTSW 8 96,489,772 (GRCm39) missense probably damaging 1.00
R0335:Cnot1 UTSW 8 96,498,628 (GRCm39) missense probably benign 0.02
R0409:Cnot1 UTSW 8 96,475,483 (GRCm39) missense probably damaging 0.96
R0445:Cnot1 UTSW 8 96,486,836 (GRCm39) missense probably damaging 1.00
R1505:Cnot1 UTSW 8 96,455,295 (GRCm39) missense probably damaging 1.00
R1517:Cnot1 UTSW 8 96,469,841 (GRCm39) missense probably benign 0.38
R1640:Cnot1 UTSW 8 96,496,460 (GRCm39) missense probably damaging 0.98
R1737:Cnot1 UTSW 8 96,474,904 (GRCm39) missense probably damaging 0.98
R1755:Cnot1 UTSW 8 96,451,205 (GRCm39) missense probably damaging 1.00
R1901:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 96,468,572 (GRCm39) missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 96,451,221 (GRCm39) missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 96,466,469 (GRCm39) missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 96,501,986 (GRCm39) missense probably damaging 1.00
R2116:Cnot1 UTSW 8 96,452,781 (GRCm39) missense probably damaging 1.00
R2191:Cnot1 UTSW 8 96,488,054 (GRCm39) missense probably damaging 0.98
R2238:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2239:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2251:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2252:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2253:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2315:Cnot1 UTSW 8 96,475,690 (GRCm39) missense probably damaging 1.00
R2431:Cnot1 UTSW 8 96,501,280 (GRCm39) missense probably damaging 1.00
R2988:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3109:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3114:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
R4359:Cnot1 UTSW 8 96,466,476 (GRCm39) missense probably damaging 1.00
R4382:Cnot1 UTSW 8 96,496,407 (GRCm39) missense probably damaging 0.97
R4747:Cnot1 UTSW 8 96,501,310 (GRCm39) missense probably benign 0.27
R4910:Cnot1 UTSW 8 96,459,859 (GRCm39) missense probably benign 0.43
R4913:Cnot1 UTSW 8 96,489,695 (GRCm39) missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 96,448,254 (GRCm39) missense probably damaging 1.00
R5056:Cnot1 UTSW 8 96,467,636 (GRCm39) missense probably damaging 1.00
R5092:Cnot1 UTSW 8 96,479,396 (GRCm39) missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 96,486,815 (GRCm39) missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 96,483,983 (GRCm39) missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 96,470,924 (GRCm39) missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 96,460,775 (GRCm39) nonsense probably null
R5956:Cnot1 UTSW 8 96,481,606 (GRCm39) critical splice donor site probably null
R5981:Cnot1 UTSW 8 96,515,293 (GRCm39) missense probably damaging 1.00
R6093:Cnot1 UTSW 8 96,475,522 (GRCm39) missense probably benign 0.03
R6108:Cnot1 UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
R6261:Cnot1 UTSW 8 96,468,549 (GRCm39) missense probably benign 0.00
R6632:Cnot1 UTSW 8 96,499,895 (GRCm39) intron probably benign
R6882:Cnot1 UTSW 8 96,447,054 (GRCm39) missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 96,451,160 (GRCm39) missense probably damaging 1.00
R6985:Cnot1 UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
R7210:Cnot1 UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
R7410:Cnot1 UTSW 8 96,459,787 (GRCm39) missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 96,454,276 (GRCm39) missense probably damaging 1.00
R7624:Cnot1 UTSW 8 96,478,447 (GRCm39) missense probably damaging 1.00
R7695:Cnot1 UTSW 8 96,497,260 (GRCm39) missense probably benign 0.03
R7703:Cnot1 UTSW 8 96,486,726 (GRCm39) critical splice donor site probably null
R7771:Cnot1 UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
R7800:Cnot1 UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
R7809:Cnot1 UTSW 8 96,478,406 (GRCm39) missense probably damaging 1.00
R7857:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7914:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7924:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7926:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7981:Cnot1 UTSW 8 96,489,797 (GRCm39) missense probably damaging 1.00
R8004:Cnot1 UTSW 8 96,479,380 (GRCm39) missense probably benign 0.03
R8061:Cnot1 UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 96,487,979 (GRCm39) missense probably damaging 1.00
R8269:Cnot1 UTSW 8 96,478,389 (GRCm39) missense probably damaging 1.00
R8306:Cnot1 UTSW 8 96,473,649 (GRCm39) missense probably benign 0.05
R8322:Cnot1 UTSW 8 96,496,472 (GRCm39) missense probably benign 0.00
R8427:Cnot1 UTSW 8 96,460,952 (GRCm39) missense probably benign 0.01
R8723:Cnot1 UTSW 8 96,462,907 (GRCm39) missense probably benign 0.00
R8934:Cnot1 UTSW 8 96,491,695 (GRCm39) missense probably benign 0.04
R9025:Cnot1 UTSW 8 96,475,660 (GRCm39) missense probably benign
R9179:Cnot1 UTSW 8 96,500,054 (GRCm39) missense probably benign 0.16
R9280:Cnot1 UTSW 8 96,497,227 (GRCm39) missense probably benign 0.15
R9285:Cnot1 UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
R9299:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9337:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9480:Cnot1 UTSW 8 96,497,338 (GRCm39) missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 96,482,854 (GRCm39) missense probably benign 0.02
R9601:Cnot1 UTSW 8 96,482,835 (GRCm39) missense probably benign 0.02
R9629:Cnot1 UTSW 8 96,455,874 (GRCm39) missense probably damaging 0.98
R9752:Cnot1 UTSW 8 96,488,019 (GRCm39) missense probably damaging 1.00
R9764:Cnot1 UTSW 8 96,496,209 (GRCm39) missense probably benign 0.00
R9789:Cnot1 UTSW 8 96,455,772 (GRCm39) missense probably damaging 1.00
X0050:Cnot1 UTSW 8 96,469,726 (GRCm39) splice site probably null
Z1176:Cnot1 UTSW 8 96,474,905 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCACACCCACTGGCTTTTC -3'
(R):5'- CACGGGATAGGTCTGCTTTG -3'

Sequencing Primer
(F):5'- GGCTTTTCTGTATCCTAAAAGAGCC -3'
(R):5'- GGGTAGGTGCTCAGAATTGATTTC -3'
Posted On 2020-08-01