Incidental Mutation 'BB001:Obscn'
ID 642116
Institutional Source Beutler Lab
Gene Symbol Obscn
Ensembl Gene ENSMUSG00000061462
Gene Name obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms OTTMUSG00000005786, LOC380698
Accession Numbers
Essential gene? Probably essential (E-score: 0.777) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 58885082-59027201 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 59003381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 1306 (E1306Q)
Ref Sequence ENSEMBL: ENSMUSP00000038264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020732] [ENSMUST00000047441] [ENSMUST00000052872]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000020732
Gene: ENSMUSG00000061462
AA Change: E1398Q

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 4.49e-6 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 2.54e-5 SMART
IGc2 1152 1218 4.49e-6 SMART
IGc2 1244 1310 7.82e-6 SMART
IGc2 1336 1402 5.16e-6 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 1.93e-5 SMART
IGc2 1888 1954 1.93e-5 SMART
IGc2 1980 2046 7.94e-7 SMART
IGc2 2072 2138 6.35e-6 SMART
IG 2158 2238 5.37e-4 SMART
IG 2248 2327 9.93e-8 SMART
IG 2338 2417 2.48e-8 SMART
IG 2427 2506 3.89e-1 SMART
IG 2516 2595 1.92e0 SMART
IG 2605 2683 6.45e-7 SMART
IG 2728 2807 1.22e-7 SMART
IGc2 2913 2979 9.93e-8 SMART
low complexity region 2981 2992 N/A INTRINSIC
IG 2996 3075 2.44e0 SMART
IGc2 3091 3157 2.1e-6 SMART
IG 3174 3255 2.86e0 SMART
IGc2 3271 3337 8.38e-6 SMART
IG 3354 3433 1.2e-6 SMART
IG 3443 3524 1.42e-3 SMART
IGc2 3540 3606 3.85e-5 SMART
IGc2 3629 3695 3.13e-5 SMART
IGc2 3718 3783 3.3e-4 SMART
IGc2 3806 3871 5.84e-5 SMART
IGc2 3894 3959 1.29e-6 SMART
IG_like 3982 4047 5.5e-1 SMART
IGc2 4054 4119 1.46e-5 SMART
IGc2 4142 4207 1.25e-4 SMART
IGc2 4230 4295 1.56e-5 SMART
IGc2 4318 4383 1.19e-5 SMART
IG_like 4400 4479 2.1e1 SMART
IGc2 4495 4560 1.93e-5 SMART
IGc2 4583 4648 3.91e-6 SMART
IG 4665 4743 1.85e-7 SMART
IG 4753 4831 1.03e-5 SMART
IGc2 4847 4912 5.08e-5 SMART
IGc2 4935 5001 5.08e-5 SMART
IGc2 5024 5090 1.11e-5 SMART
IGc2 5113 5181 6.71e-5 SMART
IG 5198 5280 2.06e-5 SMART
low complexity region 5307 5321 N/A INTRINSIC
IG 5377 5459 1.04e-1 SMART
IG 5469 5551 9.12e-7 SMART
FN3 5554 5636 2.44e-14 SMART
IG 5658 5740 3.68e-2 SMART
IQ 5900 5922 3.65e-4 SMART
IGc2 5939 6007 8.72e-4 SMART
low complexity region 6015 6031 N/A INTRINSIC
low complexity region 6032 6048 N/A INTRINSIC
low complexity region 6051 6074 N/A INTRINSIC
IGc2 6169 6237 3.25e-12 SMART
low complexity region 6250 6266 N/A INTRINSIC
IG 6296 6380 1.55e0 SMART
IGc2 6412 6485 1.82e-6 SMART
low complexity region 6599 6629 N/A INTRINSIC
SH3 6632 6695 1.22e0 SMART
Pfam:RhoGEF 6726 6904 2.8e-22 PFAM
PH 6925 7035 2.74e-11 SMART
IGc2 7055 7123 3.73e-12 SMART
IGc2 7149 7218 1.18e-14 SMART
low complexity region 7259 7273 N/A INTRINSIC
low complexity region 7274 7301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047441
AA Change: E1306Q

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462
AA Change: E1306Q

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052872
AA Change: E1331Q

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049737
Gene: ENSMUSG00000061462
AA Change: E1331Q

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 809 875 4.49e-6 SMART
IGc2 901 967 2.54e-5 SMART
IGc2 993 1059 2.54e-5 SMART
IGc2 1085 1151 4.49e-6 SMART
IGc2 1177 1243 7.82e-6 SMART
IGc2 1269 1335 5.16e-6 SMART
IGc2 1361 1427 1.93e-5 SMART
IGc2 1453 1519 1.93e-5 SMART
IGc2 1545 1611 1.93e-5 SMART
IGc2 1637 1703 1.93e-5 SMART
IGc2 1729 1795 1.93e-5 SMART
IGc2 1821 1887 1.93e-5 SMART
IGc2 1913 1979 7.94e-7 SMART
IGc2 2005 2071 6.35e-6 SMART
IG 2091 2171 5.37e-4 SMART
IG 2181 2260 9.93e-8 SMART
IG 2271 2350 2.48e-8 SMART
IG 2360 2439 3.89e-1 SMART
IG 2449 2528 1.92e0 SMART
IG 2538 2616 6.45e-7 SMART
IG 2661 2740 1.22e-7 SMART
IGc2 2846 2912 9.93e-8 SMART
low complexity region 2914 2925 N/A INTRINSIC
IG 2929 3008 2.44e0 SMART
IGc2 3024 3090 2.1e-6 SMART
IG 3107 3188 2.86e0 SMART
IGc2 3204 3270 8.38e-6 SMART
IG 3287 3366 1.2e-6 SMART
IG 3376 3457 1.42e-3 SMART
IGc2 3473 3539 3.85e-5 SMART
IGc2 3562 3628 3.13e-5 SMART
IGc2 3651 3716 3.3e-4 SMART
IGc2 3739 3804 5.84e-5 SMART
IGc2 3827 3892 1.29e-6 SMART
IG_like 3915 3980 3.16e-1 SMART
IGc2 3988 4053 1.46e-5 SMART
IGc2 4076 4141 1.25e-4 SMART
IGc2 4164 4229 1.56e-5 SMART
IGc2 4252 4317 1.19e-5 SMART
IGc2 4340 4405 1.93e-5 SMART
IGc2 4428 4493 3.91e-6 SMART
IG 4510 4588 1.85e-7 SMART
IG 4598 4676 1.03e-5 SMART
IGc2 4692 4757 5.08e-5 SMART
IGc2 4780 4846 5.08e-5 SMART
IGc2 4869 4935 1.11e-5 SMART
IGc2 4958 5026 6.71e-5 SMART
IG 5043 5125 2.06e-5 SMART
IG 5135 5216 5.01e-4 SMART
IG 5225 5307 1.04e-1 SMART
IG 5317 5399 9.12e-7 SMART
FN3 5402 5484 2.44e-14 SMART
IG 5511 5593 3.68e-2 SMART
IQ 5753 5775 3.65e-4 SMART
IGc2 5792 5860 8.72e-4 SMART
low complexity region 5868 5884 N/A INTRINSIC
low complexity region 5885 5901 N/A INTRINSIC
low complexity region 5904 5927 N/A INTRINSIC
IGc2 6022 6090 3.25e-12 SMART
low complexity region 6103 6119 N/A INTRINSIC
IG 6149 6233 1.55e0 SMART
IGc2 6265 6338 1.82e-6 SMART
low complexity region 6452 6482 N/A INTRINSIC
SH3 6485 6548 1.22e0 SMART
Pfam:RhoGEF 6579 6757 2.1e-21 PFAM
PH 6778 6888 2.74e-11 SMART
IGc2 6908 6976 3.73e-12 SMART
IGc2 7002 7071 1.18e-14 SMART
low complexity region 7112 7126 N/A INTRINSIC
low complexity region 7127 7154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 800 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein is one of three giant sacromeric signaling proteins that includes titin and nebulin. It may have a role in the organization of myofibrils during assembly and also may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been described although the full-length nature is not known for all splicing variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit centrally localized nuclei in muscle fibers and mild myopathy in aged mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Obscn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Obscn APN 11 58,892,883 (GRCm39) missense probably benign 0.01
IGL00417:Obscn APN 11 58,897,614 (GRCm39) missense unknown
IGL01018:Obscn APN 11 59,018,895 (GRCm39) missense probably damaging 0.99
IGL01083:Obscn APN 11 58,926,919 (GRCm39) missense probably damaging 0.99
IGL01109:Obscn APN 11 59,024,588 (GRCm39) missense probably damaging 1.00
IGL01139:Obscn APN 11 58,969,178 (GRCm39) missense probably damaging 1.00
IGL01361:Obscn APN 11 58,919,715 (GRCm39) missense probably damaging 0.99
IGL01370:Obscn APN 11 58,886,389 (GRCm39) critical splice acceptor site probably null
IGL01409:Obscn APN 11 58,921,884 (GRCm39) missense probably damaging 1.00
IGL01432:Obscn APN 11 58,924,583 (GRCm39) missense probably benign 0.27
IGL01527:Obscn APN 11 58,955,243 (GRCm39) missense possibly damaging 0.83
IGL01543:Obscn APN 11 58,932,943 (GRCm39) missense probably benign 0.01
IGL01578:Obscn APN 11 58,890,506 (GRCm39) missense unknown
IGL01603:Obscn APN 11 58,928,631 (GRCm39) missense probably damaging 1.00
IGL01750:Obscn APN 11 58,922,465 (GRCm39) missense probably damaging 1.00
IGL01765:Obscn APN 11 59,006,610 (GRCm39) missense possibly damaging 0.58
IGL01805:Obscn APN 11 59,023,422 (GRCm39) missense probably damaging 0.99
IGL01816:Obscn APN 11 58,886,605 (GRCm39) splice site probably benign
IGL01885:Obscn APN 11 58,965,794 (GRCm39) missense possibly damaging 0.60
IGL01911:Obscn APN 11 58,899,421 (GRCm39) nonsense probably null
IGL01963:Obscn APN 11 58,911,367 (GRCm39) missense probably benign 0.16
IGL02012:Obscn APN 11 58,967,333 (GRCm39) missense probably benign 0.03
IGL02096:Obscn APN 11 58,971,530 (GRCm39) missense probably damaging 0.98
IGL02125:Obscn APN 11 58,913,188 (GRCm39) missense probably damaging 1.00
IGL02125:Obscn APN 11 58,984,152 (GRCm39) missense possibly damaging 0.95
IGL02203:Obscn APN 11 58,973,134 (GRCm39) missense probably damaging 1.00
IGL02232:Obscn APN 11 58,929,804 (GRCm39) missense probably damaging 0.97
IGL02262:Obscn APN 11 58,919,359 (GRCm39) missense possibly damaging 0.88
IGL02304:Obscn APN 11 58,967,448 (GRCm39) missense probably damaging 1.00
IGL02306:Obscn APN 11 58,890,497 (GRCm39) missense unknown
IGL02323:Obscn APN 11 58,899,348 (GRCm39) missense possibly damaging 0.51
IGL02341:Obscn APN 11 59,026,651 (GRCm39) missense probably benign 0.09
IGL02342:Obscn APN 11 58,891,914 (GRCm39) missense probably benign 0.00
IGL02352:Obscn APN 11 58,891,853 (GRCm39) missense probably benign 0.10
IGL02397:Obscn APN 11 58,967,725 (GRCm39) missense possibly damaging 0.67
IGL02405:Obscn APN 11 59,023,428 (GRCm39) missense probably damaging 0.96
IGL02427:Obscn APN 11 58,957,988 (GRCm39) missense probably damaging 1.00
IGL02479:Obscn APN 11 58,947,053 (GRCm39) splice site probably benign
IGL02512:Obscn APN 11 58,919,343 (GRCm39) missense probably damaging 1.00
IGL02566:Obscn APN 11 58,958,973 (GRCm39) missense probably damaging 1.00
IGL02613:Obscn APN 11 58,892,958 (GRCm39) missense probably benign 0.03
IGL02634:Obscn APN 11 58,945,611 (GRCm39) missense probably damaging 1.00
IGL02680:Obscn APN 11 58,890,846 (GRCm39) missense unknown
IGL02715:Obscn APN 11 58,971,137 (GRCm39) missense probably benign 0.25
IGL02718:Obscn APN 11 58,968,684 (GRCm39) missense probably damaging 1.00
IGL02723:Obscn APN 11 59,015,446 (GRCm39) missense probably benign 0.17
IGL02735:Obscn APN 11 58,984,175 (GRCm39) missense probably damaging 1.00
IGL02951:Obscn APN 11 58,885,339 (GRCm39) splice site probably benign
IGL03004:Obscn APN 11 58,919,413 (GRCm39) missense probably damaging 1.00
IGL03078:Obscn APN 11 58,969,624 (GRCm39) splice site probably null
IGL03114:Obscn APN 11 58,891,365 (GRCm39) missense unknown
IGL03125:Obscn APN 11 58,952,474 (GRCm39) missense probably damaging 1.00
IGL03150:Obscn APN 11 58,942,549 (GRCm39) missense probably damaging 1.00
IGL03156:Obscn APN 11 58,945,722 (GRCm39) missense probably damaging 1.00
IGL03169:Obscn APN 11 58,964,122 (GRCm39) missense probably damaging 1.00
IGL03297:Obscn APN 11 58,951,712 (GRCm39) missense possibly damaging 0.83
IGL03326:Obscn APN 11 58,923,728 (GRCm39) missense probably damaging 1.00
IGL03345:Obscn APN 11 58,886,308 (GRCm39) unclassified probably benign
IGL03348:Obscn APN 11 58,941,188 (GRCm39) missense probably damaging 1.00
IGL03355:Obscn APN 11 58,928,618 (GRCm39) missense probably damaging 1.00
IGL03377:Obscn APN 11 58,890,699 (GRCm39) missense probably damaging 1.00
IGL03396:Obscn APN 11 58,964,404 (GRCm39) missense probably benign 0.12
IGL03405:Obscn APN 11 58,890,950 (GRCm39) missense unknown
boeuf UTSW 11 59,024,020 (GRCm39) missense probably benign 0.37
Bull UTSW 11 58,923,744 (GRCm39) missense possibly damaging 0.85
Deluge UTSW 11 58,898,440 (GRCm39) missense unknown
ducking UTSW 11 58,971,795 (GRCm39) unclassified probably benign
Goose UTSW 11 58,941,306 (GRCm39) missense probably benign 0.23
Obscurity UTSW 11 58,885,526 (GRCm39) nonsense probably null
Tallow UTSW 11 58,967,819 (GRCm39) missense possibly damaging 0.95
Turducken UTSW 11 58,942,347 (GRCm39) splice site probably benign
BB002:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
BB011:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
BB012:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
IGL02802:Obscn UTSW 11 58,891,310 (GRCm39) missense unknown
N/A - 535:Obscn UTSW 11 58,891,134 (GRCm39) missense possibly damaging 0.67
PIT4131001:Obscn UTSW 11 58,957,890 (GRCm39) critical splice donor site probably null
PIT4453001:Obscn UTSW 11 58,960,660 (GRCm39) missense possibly damaging 0.76
PIT4453001:Obscn UTSW 11 58,951,802 (GRCm39) missense probably damaging 1.00
PIT4504001:Obscn UTSW 11 59,023,948 (GRCm39) missense probably damaging 1.00
PIT4651001:Obscn UTSW 11 58,932,507 (GRCm39) missense probably damaging 0.99
R0033:Obscn UTSW 11 58,885,572 (GRCm39) unclassified probably benign
R0041:Obscn UTSW 11 58,934,803 (GRCm39) missense probably damaging 1.00
R0042:Obscn UTSW 11 58,943,411 (GRCm39) missense probably damaging 1.00
R0064:Obscn UTSW 11 58,918,292 (GRCm39) missense probably damaging 1.00
R0064:Obscn UTSW 11 58,918,292 (GRCm39) missense probably damaging 1.00
R0071:Obscn UTSW 11 58,955,027 (GRCm39) missense possibly damaging 0.85
R0077:Obscn UTSW 11 58,942,347 (GRCm39) splice site probably benign
R0083:Obscn UTSW 11 58,913,200 (GRCm39) missense probably damaging 1.00
R0089:Obscn UTSW 11 58,890,888 (GRCm39) missense unknown
R0092:Obscn UTSW 11 58,942,073 (GRCm39) missense possibly damaging 0.96
R0103:Obscn UTSW 11 58,953,522 (GRCm39) nonsense probably null
R0103:Obscn UTSW 11 58,953,522 (GRCm39) nonsense probably null
R0108:Obscn UTSW 11 58,913,200 (GRCm39) missense probably damaging 1.00
R0152:Obscn UTSW 11 58,943,402 (GRCm39) missense probably benign 0.06
R0268:Obscn UTSW 11 58,958,098 (GRCm39) missense possibly damaging 0.78
R0271:Obscn UTSW 11 58,947,568 (GRCm39) intron probably benign
R0281:Obscn UTSW 11 58,929,441 (GRCm39) missense probably damaging 1.00
R0329:Obscn UTSW 11 58,943,332 (GRCm39) missense probably damaging 1.00
R0329:Obscn UTSW 11 58,931,267 (GRCm39) missense probably damaging 1.00
R0360:Obscn UTSW 11 59,019,107 (GRCm39) missense probably benign 0.22
R0364:Obscn UTSW 11 59,019,107 (GRCm39) missense probably benign 0.22
R0382:Obscn UTSW 11 58,931,132 (GRCm39) missense probably damaging 1.00
R0386:Obscn UTSW 11 59,027,165 (GRCm39) missense probably damaging 1.00
R0403:Obscn UTSW 11 58,967,366 (GRCm39) missense probably damaging 1.00
R0413:Obscn UTSW 11 58,893,823 (GRCm39) missense probably benign 0.03
R0437:Obscn UTSW 11 58,885,914 (GRCm39) unclassified probably benign
R0442:Obscn UTSW 11 58,893,000 (GRCm39) splice site probably benign
R0445:Obscn UTSW 11 58,890,161 (GRCm39) missense unknown
R0446:Obscn UTSW 11 58,886,238 (GRCm39) unclassified probably benign
R0454:Obscn UTSW 11 58,890,449 (GRCm39) missense unknown
R0463:Obscn UTSW 11 58,952,356 (GRCm39) missense probably benign 0.07
R0479:Obscn UTSW 11 59,003,533 (GRCm39) missense probably damaging 1.00
R0480:Obscn UTSW 11 59,024,772 (GRCm39) nonsense probably null
R0504:Obscn UTSW 11 58,899,333 (GRCm39) critical splice donor site probably null
R0507:Obscn UTSW 11 58,920,167 (GRCm39) missense probably damaging 1.00
R0513:Obscn UTSW 11 58,952,348 (GRCm39) missense possibly damaging 0.81
R0541:Obscn UTSW 11 58,972,810 (GRCm39) missense probably damaging 1.00
R0551:Obscn UTSW 11 58,998,688 (GRCm39) nonsense probably null
R0573:Obscn UTSW 11 58,926,905 (GRCm39) missense probably damaging 1.00
R0599:Obscn UTSW 11 58,964,522 (GRCm39) missense probably damaging 1.00
R0637:Obscn UTSW 11 58,973,602 (GRCm39) missense probably damaging 0.96
R0637:Obscn UTSW 11 58,942,470 (GRCm39) missense probably damaging 1.00
R0653:Obscn UTSW 11 58,898,534 (GRCm39) unclassified probably benign
R0712:Obscn UTSW 11 58,940,271 (GRCm39) missense possibly damaging 0.72
R0715:Obscn UTSW 11 58,941,306 (GRCm39) missense probably benign 0.23
R0729:Obscn UTSW 11 58,923,535 (GRCm39) missense probably damaging 1.00
R0741:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
R0745:Obscn UTSW 11 58,973,065 (GRCm39) missense probably benign 0.14
R0751:Obscn UTSW 11 58,972,645 (GRCm39) missense probably damaging 1.00
R0834:Obscn UTSW 11 59,024,104 (GRCm39) missense probably benign 0.25
R0863:Obscn UTSW 11 58,886,241 (GRCm39) unclassified probably benign
R0909:Obscn UTSW 11 58,965,890 (GRCm39) missense probably damaging 1.00
R0965:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R0969:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R0980:Obscn UTSW 11 58,888,887 (GRCm39) missense possibly damaging 0.92
R1017:Obscn UTSW 11 58,889,179 (GRCm39) missense unknown
R1103:Obscn UTSW 11 58,912,309 (GRCm39) missense probably damaging 1.00
R1107:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R1128:Obscn UTSW 11 58,919,769 (GRCm39) missense probably null 0.71
R1164:Obscn UTSW 11 58,926,913 (GRCm39) missense possibly damaging 0.65
R1192:Obscn UTSW 11 58,958,025 (GRCm39) missense probably benign 0.33
R1298:Obscn UTSW 11 58,945,723 (GRCm39) missense possibly damaging 0.65
R1331:Obscn UTSW 11 58,977,754 (GRCm39) missense probably benign 0.09
R1333:Obscn UTSW 11 58,971,143 (GRCm39) missense probably damaging 0.99
R1341:Obscn UTSW 11 58,920,198 (GRCm39) splice site probably benign
R1385:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R1386:Obscn UTSW 11 59,024,679 (GRCm39) missense probably damaging 1.00
R1390:Obscn UTSW 11 58,984,274 (GRCm39) missense probably damaging 1.00
R1460:Obscn UTSW 11 58,946,792 (GRCm39) missense probably damaging 1.00
R1495:Obscn UTSW 11 58,970,986 (GRCm39) missense probably damaging 0.99
R1496:Obscn UTSW 11 58,921,862 (GRCm39) missense probably benign 0.01
R1524:Obscn UTSW 11 59,006,681 (GRCm39) missense probably damaging 1.00
R1526:Obscn UTSW 11 58,919,412 (GRCm39) missense probably damaging 1.00
R1537:Obscn UTSW 11 58,891,575 (GRCm39) missense unknown
R1554:Obscn UTSW 11 58,894,474 (GRCm39) missense unknown
R1561:Obscn UTSW 11 58,926,899 (GRCm39) missense probably damaging 1.00
R1589:Obscn UTSW 11 58,926,901 (GRCm39) missense possibly damaging 0.89
R1615:Obscn UTSW 11 58,990,651 (GRCm39) missense probably benign 0.09
R1627:Obscn UTSW 11 59,003,464 (GRCm39) missense probably benign 0.14
R1634:Obscn UTSW 11 58,967,722 (GRCm39) missense probably damaging 1.00
R1636:Obscn UTSW 11 59,013,463 (GRCm39) missense probably damaging 1.00
R1681:Obscn UTSW 11 58,994,151 (GRCm39) missense probably damaging 1.00
R1686:Obscn UTSW 11 58,997,113 (GRCm39) splice site probably benign
R1713:Obscn UTSW 11 58,970,712 (GRCm39) missense probably damaging 1.00
R1730:Obscn UTSW 11 58,964,459 (GRCm39) missense probably damaging 1.00
R1781:Obscn UTSW 11 58,997,163 (GRCm39) missense probably damaging 1.00
R1783:Obscn UTSW 11 58,964,459 (GRCm39) missense probably damaging 1.00
R1793:Obscn UTSW 11 58,968,606 (GRCm39) missense probably damaging 1.00
R1796:Obscn UTSW 11 58,920,163 (GRCm39) missense possibly damaging 0.94
R1801:Obscn UTSW 11 58,889,147 (GRCm39) missense unknown
R1824:Obscn UTSW 11 58,885,658 (GRCm39) unclassified probably benign
R1856:Obscn UTSW 11 58,931,122 (GRCm39) missense probably damaging 1.00
R1866:Obscn UTSW 11 58,951,741 (GRCm39) missense probably benign 0.34
R1878:Obscn UTSW 11 58,886,379 (GRCm39) missense probably damaging 0.99
R1883:Obscn UTSW 11 58,969,029 (GRCm39) missense probably damaging 1.00
R1926:Obscn UTSW 11 58,954,300 (GRCm39) missense
R1967:Obscn UTSW 11 59,026,535 (GRCm39) nonsense probably null
R1975:Obscn UTSW 11 58,958,555 (GRCm39) missense probably damaging 1.00
R1992:Obscn UTSW 11 58,886,653 (GRCm39) unclassified probably benign
R2021:Obscn UTSW 11 58,958,000 (GRCm39) missense probably benign 0.40
R2066:Obscn UTSW 11 59,026,558 (GRCm39) missense possibly damaging 0.59
R2074:Obscn UTSW 11 59,023,478 (GRCm39) missense probably damaging 1.00
R2074:Obscn UTSW 11 58,960,107 (GRCm39) missense probably damaging 0.99
R2081:Obscn UTSW 11 58,925,008 (GRCm39) missense possibly damaging 0.90
R2083:Obscn UTSW 11 58,964,457 (GRCm39) nonsense probably null
R2086:Obscn UTSW 11 58,969,082 (GRCm39) missense probably damaging 0.99
R2095:Obscn UTSW 11 58,984,410 (GRCm39) splice site probably null
R2098:Obscn UTSW 11 58,960,817 (GRCm39) missense probably damaging 1.00
R2114:Obscn UTSW 11 59,022,484 (GRCm39) missense probably damaging 0.99
R2138:Obscn UTSW 11 58,894,491 (GRCm39) nonsense probably null
R2193:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2194:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2210:Obscn UTSW 11 58,958,913 (GRCm39) missense probably damaging 1.00
R2233:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2234:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2287:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2288:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2351:Obscn UTSW 11 59,003,438 (GRCm39) missense probably damaging 0.99
R2376:Obscn UTSW 11 58,959,950 (GRCm39) missense probably damaging 1.00
R2384:Obscn UTSW 11 58,933,663 (GRCm39) critical splice donor site probably null
R2401:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2402:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2403:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2424:Obscn UTSW 11 58,885,277 (GRCm39) unclassified probably benign
R2433:Obscn UTSW 11 58,929,912 (GRCm39) splice site probably null
R2445:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2446:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2447:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2449:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2483:Obscn UTSW 11 58,970,972 (GRCm39) missense probably damaging 1.00
R2484:Obscn UTSW 11 58,898,366 (GRCm39) unclassified probably benign
R2496:Obscn UTSW 11 58,994,268 (GRCm39) missense probably damaging 1.00
R2510:Obscn UTSW 11 58,933,140 (GRCm39) splice site probably benign
R2851:Obscn UTSW 11 58,920,844 (GRCm39) critical splice donor site probably null
R2878:Obscn UTSW 11 58,947,014 (GRCm39) missense possibly damaging 0.94
R2879:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2885:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2885:Obscn UTSW 11 58,977,574 (GRCm39) missense probably damaging 1.00
R2886:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R2985:Obscn UTSW 11 59,023,915 (GRCm39) missense probably damaging 1.00
R3013:Obscn UTSW 11 58,951,744 (GRCm39) missense probably damaging 1.00
R3118:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3236:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3237:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3432:Obscn UTSW 11 58,922,003 (GRCm39) missense probably damaging 1.00
R3694:Obscn UTSW 11 58,969,221 (GRCm39) missense probably damaging 1.00
R3716:Obscn UTSW 11 58,973,487 (GRCm39) missense probably damaging 1.00
R3717:Obscn UTSW 11 58,973,487 (GRCm39) missense probably damaging 1.00
R3743:Obscn UTSW 11 58,969,911 (GRCm39) missense probably damaging 0.99
R3760:Obscn UTSW 11 58,919,406 (GRCm39) missense probably damaging 1.00
R3795:Obscn UTSW 11 58,922,667 (GRCm39) missense probably damaging 1.00
R3857:Obscn UTSW 11 58,971,795 (GRCm39) unclassified probably benign
R3858:Obscn UTSW 11 58,971,795 (GRCm39) unclassified probably benign
R3862:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3863:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3864:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3881:Obscn UTSW 11 58,947,775 (GRCm39) missense probably damaging 1.00
R3890:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3903:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3923:Obscn UTSW 11 58,951,754 (GRCm39) missense possibly damaging 0.96
R3944:Obscn UTSW 11 59,023,373 (GRCm39) missense probably damaging 1.00
R3947:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3948:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R3955:Obscn UTSW 11 58,927,594 (GRCm39) missense probably damaging 1.00
R3970:Obscn UTSW 11 58,942,488 (GRCm39) missense probably damaging 1.00
R3971:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4001:Obscn UTSW 11 59,025,395 (GRCm39) missense probably damaging 1.00
R4005:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4017:Obscn UTSW 11 59,023,448 (GRCm39) missense probably damaging 1.00
R4028:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4029:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4041:Obscn UTSW 11 58,942,357 (GRCm39) nonsense probably null
R4061:Obscn UTSW 11 58,899,358 (GRCm39) missense probably damaging 1.00
R4062:Obscn UTSW 11 58,973,536 (GRCm39) missense probably damaging 0.99
R4072:Obscn UTSW 11 58,888,009 (GRCm39) missense unknown
R4078:Obscn UTSW 11 58,929,189 (GRCm39) missense probably benign 0.41
R4079:Obscn UTSW 11 58,929,189 (GRCm39) missense probably benign 0.41
R4092:Obscn UTSW 11 58,946,886 (GRCm39) missense probably benign 0.12
R4106:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4108:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4403:Obscn UTSW 11 58,959,919 (GRCm39) missense possibly damaging 0.95
R4477:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4478:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4480:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4489:Obscn UTSW 11 58,922,417 (GRCm39) missense possibly damaging 0.74
R4531:Obscn UTSW 11 58,898,700 (GRCm39) unclassified probably benign
R4551:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4552:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4553:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4558:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
R4570:Obscn UTSW 11 58,897,654 (GRCm39) splice site probably null
R4575:Obscn UTSW 11 59,013,598 (GRCm39) missense probably damaging 0.99
R4593:Obscn UTSW 11 59,024,075 (GRCm39) missense probably damaging 1.00
R4604:Obscn UTSW 11 59,013,572 (GRCm39) missense probably damaging 0.96
R4604:Obscn UTSW 11 58,971,031 (GRCm39) missense probably damaging 1.00
R4625:Obscn UTSW 11 58,958,084 (GRCm39) missense probably damaging 1.00
R4646:Obscn UTSW 11 59,015,396 (GRCm39) nonsense probably null
R4651:Obscn UTSW 11 58,929,703 (GRCm39) missense probably damaging 1.00
R4652:Obscn UTSW 11 58,929,703 (GRCm39) missense probably damaging 1.00
R4657:Obscn UTSW 11 58,933,116 (GRCm39) missense probably damaging 1.00
R4658:Obscn UTSW 11 58,945,114 (GRCm39) nonsense probably null
R4662:Obscn UTSW 11 58,890,422 (GRCm39) missense unknown
R4665:Obscn UTSW 11 59,015,578 (GRCm39) missense probably damaging 1.00
R4718:Obscn UTSW 11 58,912,780 (GRCm39) missense probably damaging 1.00
R4736:Obscn UTSW 11 58,954,362 (GRCm39) missense probably damaging 1.00
R4746:Obscn UTSW 11 58,970,634 (GRCm39) critical splice donor site probably null
R4754:Obscn UTSW 11 58,926,869 (GRCm39) missense possibly damaging 0.81
R4758:Obscn UTSW 11 58,894,189 (GRCm39) missense unknown
R4758:Obscn UTSW 11 59,026,743 (GRCm39) missense probably damaging 0.98
R4766:Obscn UTSW 11 58,903,568 (GRCm39) missense probably damaging 1.00
R4798:Obscn UTSW 11 58,960,685 (GRCm39) missense probably damaging 0.99
R4810:Obscn UTSW 11 58,922,417 (GRCm39) missense possibly damaging 0.74
R4819:Obscn UTSW 11 58,929,674 (GRCm39) missense probably damaging 0.97
R4821:Obscn UTSW 11 58,931,293 (GRCm39) missense probably damaging 1.00
R4821:Obscn UTSW 11 58,897,652 (GRCm39) splice site probably benign
R4822:Obscn UTSW 11 58,913,159 (GRCm39) missense probably benign 0.11
R4828:Obscn UTSW 11 58,977,496 (GRCm39) missense possibly damaging 0.93
R4829:Obscn UTSW 11 58,945,072 (GRCm39) missense probably null 0.53
R4830:Obscn UTSW 11 58,958,433 (GRCm39) missense probably damaging 1.00
R4859:Obscn UTSW 11 58,972,849 (GRCm39) missense possibly damaging 0.89
R4870:Obscn UTSW 11 59,027,032 (GRCm39) missense probably damaging 1.00
R4909:Obscn UTSW 11 58,952,291 (GRCm39) missense possibly damaging 0.52
R4955:Obscn UTSW 11 58,959,998 (GRCm39) missense probably benign 0.31
R4973:Obscn UTSW 11 59,023,292 (GRCm39) missense probably damaging 1.00
R4993:Obscn UTSW 11 59,015,587 (GRCm39) missense possibly damaging 0.48
R5034:Obscn UTSW 11 58,952,502 (GRCm39) nonsense probably null
R5054:Obscn UTSW 11 58,964,443 (GRCm39) missense probably damaging 1.00
R5077:Obscn UTSW 11 58,934,883 (GRCm39) missense probably damaging 0.98
R5126:Obscn UTSW 11 58,967,889 (GRCm39) missense probably damaging 1.00
R5135:Obscn UTSW 11 59,020,479 (GRCm39) missense probably damaging 1.00
R5161:Obscn UTSW 11 58,919,430 (GRCm39) missense probably damaging 1.00
R5161:Obscn UTSW 11 58,955,136 (GRCm39) missense possibly damaging 0.60
R5195:Obscn UTSW 11 58,951,676 (GRCm39) missense possibly damaging 0.78
R5222:Obscn UTSW 11 58,934,971 (GRCm39) missense possibly damaging 0.80
R5260:Obscn UTSW 11 58,894,195 (GRCm39) missense probably damaging 1.00
R5301:Obscn UTSW 11 59,026,234 (GRCm39) missense probably damaging 1.00
R5305:Obscn UTSW 11 58,903,541 (GRCm39) missense possibly damaging 0.83
R5323:Obscn UTSW 11 58,887,703 (GRCm39) missense probably benign
R5333:Obscn UTSW 11 58,953,518 (GRCm39) missense probably damaging 1.00
R5366:Obscn UTSW 11 58,971,086 (GRCm39) missense probably damaging 1.00
R5368:Obscn UTSW 11 58,959,852 (GRCm39) critical splice donor site probably null
R5408:Obscn UTSW 11 58,942,437 (GRCm39) missense probably damaging 1.00
R5439:Obscn UTSW 11 58,890,954 (GRCm39) nonsense probably null
R5536:Obscn UTSW 11 58,998,697 (GRCm39) missense probably damaging 1.00
R5561:Obscn UTSW 11 58,926,919 (GRCm39) missense probably damaging 0.99
R5573:Obscn UTSW 11 58,925,531 (GRCm39) missense possibly damaging 0.94
R5582:Obscn UTSW 11 58,990,802 (GRCm39) splice site probably null
R5586:Obscn UTSW 11 58,892,294 (GRCm39) nonsense probably null
R5607:Obscn UTSW 11 59,013,674 (GRCm39) missense probably benign 0.22
R5700:Obscn UTSW 11 59,024,020 (GRCm39) missense probably benign 0.37
R5706:Obscn UTSW 11 58,967,082 (GRCm39) missense probably damaging 1.00
R5718:Obscn UTSW 11 58,927,634 (GRCm39) missense probably damaging 1.00
R5771:Obscn UTSW 11 58,891,533 (GRCm39) missense unknown
R5772:Obscn UTSW 11 58,946,970 (GRCm39) missense probably damaging 0.99
R5786:Obscn UTSW 11 58,923,517 (GRCm39) missense probably damaging 1.00
R5807:Obscn UTSW 11 58,970,476 (GRCm39) missense probably damaging 1.00
R5815:Obscn UTSW 11 58,973,015 (GRCm39) splice site probably null
R5835:Obscn UTSW 11 58,932,953 (GRCm39) missense probably damaging 1.00
R5835:Obscn UTSW 11 58,892,907 (GRCm39) missense probably benign 0.03
R5846:Obscn UTSW 11 58,929,435 (GRCm39) missense probably damaging 1.00
R5851:Obscn UTSW 11 58,885,526 (GRCm39) nonsense probably null
R5933:Obscn UTSW 11 58,889,331 (GRCm39) missense unknown
R5935:Obscn UTSW 11 58,897,639 (GRCm39) missense unknown
R5974:Obscn UTSW 11 58,967,373 (GRCm39) missense probably damaging 1.00
R5975:Obscn UTSW 11 59,013,445 (GRCm39) critical splice donor site probably null
R6014:Obscn UTSW 11 58,929,690 (GRCm39) missense probably damaging 1.00
R6026:Obscn UTSW 11 58,957,916 (GRCm39) missense probably damaging 0.98
R6082:Obscn UTSW 11 58,890,393 (GRCm39) missense unknown
R6124:Obscn UTSW 11 58,969,870 (GRCm39) missense probably benign 0.45
R6130:Obscn UTSW 11 58,968,771 (GRCm39) missense possibly damaging 0.90
R6160:Obscn UTSW 11 58,942,611 (GRCm39) missense probably damaging 1.00
R6169:Obscn UTSW 11 58,891,325 (GRCm39) missense unknown
R6177:Obscn UTSW 11 58,923,490 (GRCm39) missense probably damaging 1.00
R6189:Obscn UTSW 11 58,960,760 (GRCm39) missense probably benign 0.00
R6192:Obscn UTSW 11 58,888,864 (GRCm39) missense unknown
R6195:Obscn UTSW 11 58,888,033 (GRCm39) missense probably damaging 0.98
R6208:Obscn UTSW 11 58,958,474 (GRCm39) missense possibly damaging 0.81
R6232:Obscn UTSW 11 58,943,337 (GRCm39) nonsense probably null
R6233:Obscn UTSW 11 58,888,033 (GRCm39) missense probably damaging 0.98
R6273:Obscn UTSW 11 58,967,819 (GRCm39) missense possibly damaging 0.95
R6280:Obscn UTSW 11 58,954,509 (GRCm39) missense possibly damaging 0.82
R6317:Obscn UTSW 11 58,960,721 (GRCm39) missense probably damaging 1.00
R6345:Obscn UTSW 11 58,944,522 (GRCm39) missense probably damaging 0.99
R6378:Obscn UTSW 11 58,964,572 (GRCm39) missense probably damaging 1.00
R6382:Obscn UTSW 11 58,933,034 (GRCm39) missense probably damaging 0.99
R6382:Obscn UTSW 11 58,890,239 (GRCm39) missense unknown
R6415:Obscn UTSW 11 58,925,956 (GRCm39) missense probably damaging 0.99
R6433:Obscn UTSW 11 58,942,384 (GRCm39) missense probably benign 0.14
R6457:Obscn UTSW 11 58,971,597 (GRCm39) missense probably damaging 0.99
R6508:Obscn UTSW 11 58,944,973 (GRCm39) splice site probably null
R6611:Obscn UTSW 11 58,955,056 (GRCm39) splice site probably null
R6614:Obscn UTSW 11 58,903,627 (GRCm39) missense probably benign 0.01
R6645:Obscn UTSW 11 58,976,088 (GRCm39) missense probably damaging 0.97
R6646:Obscn UTSW 11 58,973,544 (GRCm39) missense possibly damaging 0.72
R6659:Obscn UTSW 11 58,929,835 (GRCm39) missense probably damaging 1.00
R6723:Obscn UTSW 11 58,945,824 (GRCm39) missense probably damaging 0.99
R6733:Obscn UTSW 11 58,919,421 (GRCm39) missense probably damaging 0.99
R6755:Obscn UTSW 11 58,994,152 (GRCm39) missense probably damaging 1.00
R6770:Obscn UTSW 11 58,934,862 (GRCm39) missense possibly damaging 0.88
R6820:Obscn UTSW 11 58,942,019 (GRCm39) missense probably damaging 1.00
R6823:Obscn UTSW 11 58,958,769 (GRCm39) critical splice donor site probably null
R6850:Obscn UTSW 11 58,958,950 (GRCm39) missense possibly damaging 0.93
R6850:Obscn UTSW 11 58,892,955 (GRCm39) missense possibly damaging 0.92
R6862:Obscn UTSW 11 58,886,279 (GRCm39) unclassified probably benign
R6884:Obscn UTSW 11 58,969,128 (GRCm39) missense probably damaging 1.00
R6894:Obscn UTSW 11 59,023,508 (GRCm39) missense probably benign 0.43
R6906:Obscn UTSW 11 58,923,744 (GRCm39) missense possibly damaging 0.85
R6944:Obscn UTSW 11 58,929,756 (GRCm39) missense probably damaging 1.00
R6948:Obscn UTSW 11 58,997,142 (GRCm39) missense probably damaging 1.00
R6959:Obscn UTSW 11 58,928,411 (GRCm39) missense probably damaging 1.00
R7000:Obscn UTSW 11 59,026,864 (GRCm39) missense probably damaging 1.00
R7028:Obscn UTSW 11 58,969,959 (GRCm39) missense probably damaging 1.00
R7037:Obscn UTSW 11 58,943,430 (GRCm39) missense probably damaging 0.98
R7037:Obscn UTSW 11 58,934,755 (GRCm39) missense probably damaging 1.00
R7056:Obscn UTSW 11 58,887,122 (GRCm39) unclassified probably benign
R7112:Obscn UTSW 11 58,920,151 (GRCm39) missense
R7121:Obscn UTSW 11 58,904,078 (GRCm39) nonsense probably null
R7123:Obscn UTSW 11 58,904,477 (GRCm39) missense probably benign
R7182:Obscn UTSW 11 58,925,927 (GRCm39) missense probably damaging 0.99
R7199:Obscn UTSW 11 58,903,672 (GRCm39) missense probably benign 0.09
R7209:Obscn UTSW 11 58,975,933 (GRCm39) nonsense probably null
R7235:Obscn UTSW 11 58,971,666 (GRCm39) missense probably damaging 0.98
R7247:Obscn UTSW 11 58,994,144 (GRCm39) nonsense probably null
R7262:Obscn UTSW 11 59,006,715 (GRCm39) missense probably damaging 0.99
R7269:Obscn UTSW 11 58,933,838 (GRCm39) missense probably damaging 0.99
R7270:Obscn UTSW 11 58,920,312 (GRCm39) missense
R7274:Obscn UTSW 11 59,024,053 (GRCm39) missense probably damaging 1.00
R7312:Obscn UTSW 11 58,946,442 (GRCm39) missense probably benign 0.00
R7313:Obscn UTSW 11 58,898,414 (GRCm39) missense unknown
R7360:Obscn UTSW 11 58,973,185 (GRCm39) missense probably damaging 1.00
R7380:Obscn UTSW 11 58,947,740 (GRCm39) missense
R7389:Obscn UTSW 11 58,927,226 (GRCm39) missense probably benign 0.02
R7402:Obscn UTSW 11 58,886,275 (GRCm39) missense unknown
R7417:Obscn UTSW 11 59,020,403 (GRCm39) missense possibly damaging 0.93
R7432:Obscn UTSW 11 58,919,733 (GRCm39) missense
R7456:Obscn UTSW 11 58,899,384 (GRCm39) missense probably benign 0.01
R7459:Obscn UTSW 11 59,022,483 (GRCm39) missense probably benign 0.00
R7463:Obscn UTSW 11 59,013,686 (GRCm39) missense probably benign 0.02
R7478:Obscn UTSW 11 58,984,242 (GRCm39) missense probably damaging 1.00
R7498:Obscn UTSW 11 58,973,539 (GRCm39) missense probably damaging 1.00
R7502:Obscn UTSW 11 58,885,635 (GRCm39) missense unknown
R7509:Obscn UTSW 11 58,942,455 (GRCm39) missense probably benign 0.36
R7516:Obscn UTSW 11 59,015,416 (GRCm39) nonsense probably null
R7545:Obscn UTSW 11 58,929,725 (GRCm39) missense probably damaging 1.00
R7549:Obscn UTSW 11 58,933,664 (GRCm39) critical splice donor site probably null
R7582:Obscn UTSW 11 58,952,253 (GRCm39) nonsense probably null
R7607:Obscn UTSW 11 58,889,091 (GRCm39) missense unknown
R7609:Obscn UTSW 11 58,891,125 (GRCm39) missense unknown
R7647:Obscn UTSW 11 58,888,113 (GRCm39) critical splice acceptor site probably null
R7650:Obscn UTSW 11 58,951,820 (GRCm39) missense probably benign 0.01
R7673:Obscn UTSW 11 58,918,263 (GRCm39) missense
R7743:Obscn UTSW 11 58,990,603 (GRCm39) missense probably damaging 1.00
R7745:Obscn UTSW 11 58,951,681 (GRCm39) missense probably damaging 1.00
R7823:Obscn UTSW 11 58,998,766 (GRCm39) missense probably damaging 1.00
R7840:Obscn UTSW 11 58,968,776 (GRCm39) missense possibly damaging 0.88
R7854:Obscn UTSW 11 58,981,538 (GRCm39) missense probably benign 0.14
R7867:Obscn UTSW 11 58,891,652 (GRCm39) missense unknown
R7874:Obscn UTSW 11 59,024,102 (GRCm39) missense probably damaging 1.00
R7877:Obscn UTSW 11 59,024,588 (GRCm39) missense probably damaging 1.00
R7883:Obscn UTSW 11 58,960,835 (GRCm39) nonsense probably null
R7903:Obscn UTSW 11 58,969,942 (GRCm39) missense probably benign 0.15
R7924:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
R7925:Obscn UTSW 11 59,003,381 (GRCm39) missense probably benign 0.27
R7936:Obscn UTSW 11 58,941,334 (GRCm39) missense possibly damaging 0.46
R7944:Obscn UTSW 11 58,984,235 (GRCm39) missense probably damaging 1.00
R7945:Obscn UTSW 11 58,984,235 (GRCm39) missense probably damaging 1.00
R7984:Obscn UTSW 11 58,997,151 (GRCm39) missense possibly damaging 0.91
R8042:Obscn UTSW 11 58,931,143 (GRCm39) missense possibly damaging 0.61
R8073:Obscn UTSW 11 59,026,516 (GRCm39) missense probably benign 0.25
R8079:Obscn UTSW 11 58,972,731 (GRCm39) missense possibly damaging 0.84
R8108:Obscn UTSW 11 58,952,460 (GRCm39) missense probably benign 0.17
R8117:Obscn UTSW 11 58,932,980 (GRCm39) missense possibly damaging 0.91
R8130:Obscn UTSW 11 59,015,439 (GRCm39) missense probably damaging 1.00
R8135:Obscn UTSW 11 58,922,703 (GRCm39) missense possibly damaging 0.60
R8175:Obscn UTSW 11 58,886,786 (GRCm39) missense unknown
R8205:Obscn UTSW 11 58,898,697 (GRCm39) missense unknown
R8211:Obscn UTSW 11 59,006,620 (GRCm39) missense probably damaging 0.99
R8219:Obscn UTSW 11 59,013,574 (GRCm39) missense probably benign 0.03
R8245:Obscn UTSW 11 58,913,066 (GRCm39) missense
R8290:Obscn UTSW 11 59,015,400 (GRCm39) missense probably damaging 0.99
R8290:Obscn UTSW 11 58,953,536 (GRCm39) missense probably damaging 1.00
R8300:Obscn UTSW 11 58,933,896 (GRCm39) missense probably benign 0.02
R8346:Obscn UTSW 11 58,976,007 (GRCm39) missense possibly damaging 0.80
R8384:Obscn UTSW 11 58,975,935 (GRCm39) missense probably damaging 0.98
R8390:Obscn UTSW 11 58,892,870 (GRCm39) missense probably benign 0.03
R8396:Obscn UTSW 11 58,893,829 (GRCm39) missense probably benign 0.03
R8443:Obscn UTSW 11 58,929,700 (GRCm39) missense probably damaging 0.99
R8469:Obscn UTSW 11 59,019,063 (GRCm39) missense probably damaging 1.00
R8503:Obscn UTSW 11 58,891,443 (GRCm39) missense unknown
R8683:Obscn UTSW 11 58,967,705 (GRCm39) missense probably benign 0.45
R8688:Obscn UTSW 11 58,946,909 (GRCm39) missense probably damaging 1.00
R8711:Obscn UTSW 11 58,951,894 (GRCm39) missense probably damaging 0.96
R8713:Obscn UTSW 11 59,026,792 (GRCm39) missense probably benign 0.03
R8803:Obscn UTSW 11 58,945,229 (GRCm39) missense probably benign
R8807:Obscn UTSW 11 58,970,470 (GRCm39) missense probably damaging 0.99
R8812:Obscn UTSW 11 58,925,921 (GRCm39) missense probably damaging 1.00
R8842:Obscn UTSW 11 58,892,861 (GRCm39) missense possibly damaging 0.56
R8852:Obscn UTSW 11 58,898,440 (GRCm39) missense unknown
R8860:Obscn UTSW 11 58,898,440 (GRCm39) missense unknown
R8878:Obscn UTSW 11 58,890,638 (GRCm39) missense unknown
R8902:Obscn UTSW 11 59,026,762 (GRCm39) missense probably benign 0.03
R8905:Obscn UTSW 11 58,960,784 (GRCm39) missense probably damaging 0.96
R8925:Obscn UTSW 11 58,977,695 (GRCm39) missense possibly damaging 0.90
R8927:Obscn UTSW 11 58,977,695 (GRCm39) missense possibly damaging 0.90
R8934:Obscn UTSW 11 58,889,085 (GRCm39) critical splice donor site probably null
R8936:Obscn UTSW 11 58,892,858 (GRCm39) missense probably benign 0.36
R8950:Obscn UTSW 11 58,947,009 (GRCm39) missense probably damaging 0.99
R8952:Obscn UTSW 11 59,026,960 (GRCm39) missense probably damaging 1.00
R8958:Obscn UTSW 11 58,964,158 (GRCm39) missense probably damaging 0.99
R8960:Obscn UTSW 11 58,922,438 (GRCm39) missense probably damaging 1.00
R8967:Obscn UTSW 11 58,972,740 (GRCm39) missense probably benign 0.11
R8972:Obscn UTSW 11 58,943,442 (GRCm39) missense probably benign 0.15
R8997:Obscn UTSW 11 58,934,629 (GRCm39) intron probably benign
R9012:Obscn UTSW 11 59,021,423 (GRCm39) missense probably benign 0.01
R9053:Obscn UTSW 11 58,972,636 (GRCm39) missense probably benign 0.45
R9064:Obscn UTSW 11 58,899,935 (GRCm39) missense
R9070:Obscn UTSW 11 59,013,457 (GRCm39) missense probably damaging 1.00
R9082:Obscn UTSW 11 58,903,612 (GRCm39) missense probably benign 0.05
R9090:Obscn UTSW 11 59,006,643 (GRCm39) missense probably damaging 0.99
R9144:Obscn UTSW 11 58,960,103 (GRCm39) missense possibly damaging 0.65
R9171:Obscn UTSW 11 58,952,329 (GRCm39) missense possibly damaging 0.47
R9195:Obscn UTSW 11 58,942,040 (GRCm39) missense probably damaging 1.00
R9211:Obscn UTSW 11 59,026,693 (GRCm39) missense probably benign 0.00
R9243:Obscn UTSW 11 59,023,392 (GRCm39) missense probably benign 0.01
R9271:Obscn UTSW 11 59,006,643 (GRCm39) missense probably damaging 0.99
R9288:Obscn UTSW 11 58,976,049 (GRCm39) missense probably benign 0.00
R9297:Obscn UTSW 11 58,898,359 (GRCm39) missense unknown
R9309:Obscn UTSW 11 58,943,337 (GRCm39) missense probably damaging 0.98
R9330:Obscn UTSW 11 58,971,047 (GRCm39) missense possibly damaging 0.95
R9357:Obscn UTSW 11 58,929,592 (GRCm39) missense probably damaging 1.00
R9360:Obscn UTSW 11 58,973,650 (GRCm39) missense probably benign 0.04
R9365:Obscn UTSW 11 58,885,337 (GRCm39) critical splice acceptor site probably null
R9374:Obscn UTSW 11 58,922,787 (GRCm39) missense possibly damaging 0.90
R9388:Obscn UTSW 11 58,943,489 (GRCm39) missense probably damaging 1.00
R9391:Obscn UTSW 11 58,964,408 (GRCm39) missense probably damaging 1.00
R9395:Obscn UTSW 11 58,946,871 (GRCm39) missense probably damaging 0.99
R9406:Obscn UTSW 11 58,947,805 (GRCm39) missense
R9452:Obscn UTSW 11 58,924,962 (GRCm39) critical splice donor site probably null
R9472:Obscn UTSW 11 58,894,495 (GRCm39) missense
R9486:Obscn UTSW 11 58,918,272 (GRCm39) missense
R9515:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.01
R9585:Obscn UTSW 11 58,965,831 (GRCm39) missense probably benign 0.09
R9597:Obscn UTSW 11 59,027,009 (GRCm39) missense probably benign 0.14
R9602:Obscn UTSW 11 58,981,385 (GRCm39) missense probably damaging 0.99
R9630:Obscn UTSW 11 58,943,397 (GRCm39) missense probably benign 0.16
R9632:Obscn UTSW 11 58,943,397 (GRCm39) missense probably benign 0.16
R9635:Obscn UTSW 11 58,972,686 (GRCm39) missense possibly damaging 0.77
R9710:Obscn UTSW 11 58,943,397 (GRCm39) missense probably benign 0.16
R9750:Obscn UTSW 11 59,024,682 (GRCm39) missense probably benign 0.22
R9757:Obscn UTSW 11 58,892,338 (GRCm39) missense probably benign 0.04
R9779:Obscn UTSW 11 59,026,441 (GRCm39) missense probably benign 0.19
R9788:Obscn UTSW 11 58,969,678 (GRCm39) missense possibly damaging 0.68
R9802:Obscn UTSW 11 58,885,189 (GRCm39) missense unknown
X0010:Obscn UTSW 11 58,886,379 (GRCm39) unclassified probably benign
X0012:Obscn UTSW 11 58,897,602 (GRCm39) missense unknown
X0021:Obscn UTSW 11 58,968,732 (GRCm39) missense probably damaging 0.96
X0058:Obscn UTSW 11 58,926,794 (GRCm39) missense probably damaging 1.00
X0061:Obscn UTSW 11 58,968,656 (GRCm39) missense probably damaging 1.00
X0063:Obscn UTSW 11 58,890,882 (GRCm39) missense unknown
X0067:Obscn UTSW 11 59,022,627 (GRCm39) missense probably benign 0.19
Y4336:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
Y4337:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
Y4338:Obscn UTSW 11 59,022,472 (GRCm39) missense possibly damaging 0.90
Y5407:Obscn UTSW 11 58,912,769 (GRCm39) missense probably damaging 0.97
Z1176:Obscn UTSW 11 58,885,198 (GRCm39) missense unknown
Z1176:Obscn UTSW 11 58,886,356 (GRCm39) missense unknown
Z1176:Obscn UTSW 11 58,929,633 (GRCm39) missense probably damaging 1.00
Z1176:Obscn UTSW 11 58,931,173 (GRCm39) missense probably benign 0.39
Z1176:Obscn UTSW 11 58,940,551 (GRCm39) missense probably benign 0.01
Z1176:Obscn UTSW 11 58,973,649 (GRCm39) missense probably benign 0.25
Z1176:Obscn UTSW 11 59,027,112 (GRCm39) missense probably benign 0.39
Z1177:Obscn UTSW 11 58,951,841 (GRCm39) missense possibly damaging 0.68
Z1177:Obscn UTSW 11 58,946,865 (GRCm39) missense probably damaging 1.00
Z1177:Obscn UTSW 11 58,946,316 (GRCm39) missense probably damaging 1.00
Z1177:Obscn UTSW 11 58,942,369 (GRCm39) missense probably damaging 0.98
Z1177:Obscn UTSW 11 58,901,270 (GRCm39) missense
Z1177:Obscn UTSW 11 58,891,781 (GRCm39) missense probably benign 0.04
Z1177:Obscn UTSW 11 59,026,292 (GRCm39) missense possibly damaging 0.50
Z1177:Obscn UTSW 11 58,953,713 (GRCm39) missense probably damaging 1.00
Z1177:Obscn UTSW 11 58,952,913 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1186:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1186:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1186:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1186:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1186:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1186:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1186:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1186:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1186:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1186:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1186:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1186:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1186:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1186:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1186:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1186:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1186:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1186:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1186:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1186:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1186:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1186:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1186:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1186:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1186:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1186:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1186:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1186:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1186:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1186:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1186:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1187:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1187:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1187:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1187:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1187:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,960,659 (GRCm39) synonymous silent
Z1187:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1187:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1187:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1187:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1187:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1187:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1187:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1187:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1187:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1187:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1187:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1187:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1187:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1187:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1187:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1187:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1187:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1187:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1187:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1187:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1187:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1187:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1187:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1187:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1187:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1187:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1187:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1188:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1188:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1188:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1188:Obscn UTSW 11 58,952,965 (GRCm39) missense probably damaging 0.97
Z1188:Obscn UTSW 11 58,952,959 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,952,408 (GRCm39) missense probably benign 0.37
Z1188:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1188:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1188:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1188:Obscn UTSW 11 58,946,283 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,945,660 (GRCm39) missense probably benign 0.04
Z1188:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1188:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1188:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1188:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1188:Obscn UTSW 11 59,020,513 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1188:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1188:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 59,003,462 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1188:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1188:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1188:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1188:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1188:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1188:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1188:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1188:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1188:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1188:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1188:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1188:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1188:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1188:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1188:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1188:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,981,573 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1188:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1188:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1188:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1188:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1189:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1189:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1189:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1189:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1189:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1189:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1189:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1189:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1189:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1189:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1189:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1189:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1189:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1189:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1189:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1189:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1189:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1189:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1189:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1189:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1189:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1189:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1189:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1189:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1189:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1189:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1190:Obscn UTSW 11 58,977,755 (GRCm39) missense probably benign 0.15
Z1190:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1190:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1190:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1190:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1190:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1190:Obscn UTSW 11 58,952,965 (GRCm39) missense probably damaging 0.97
Z1190:Obscn UTSW 11 58,952,408 (GRCm39) missense probably benign 0.37
Z1190:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1190:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1190:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1190:Obscn UTSW 11 58,946,283 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1190:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1190:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1190:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1190:Obscn UTSW 11 59,013,664 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1190:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1190:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1190:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1190:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1190:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1190:Obscn UTSW 11 58,945,660 (GRCm39) missense probably benign 0.04
Z1190:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1190:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1190:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1190:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1190:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1190:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1190:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1190:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1190:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1190:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1190:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1190:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1190:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1190:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1190:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1191:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,954,300 (GRCm39) missense
Z1191:Obscn UTSW 11 58,954,279 (GRCm39) frame shift probably null
Z1191:Obscn UTSW 11 58,952,965 (GRCm39) missense probably damaging 0.97
Z1191:Obscn UTSW 11 58,952,959 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,952,408 (GRCm39) missense probably benign 0.37
Z1191:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,951,823 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1191:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1191:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1191:Obscn UTSW 11 58,946,283 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,945,660 (GRCm39) missense probably benign 0.04
Z1191:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1191:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1191:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1191:Obscn UTSW 11 59,020,663 (GRCm39) missense probably benign 0.11
Z1191:Obscn UTSW 11 59,020,513 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 59,019,075 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1191:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1191:Obscn UTSW 11 59,013,664 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 59,003,462 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,994,340 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1191:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1191:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1191:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1191:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1191:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1191:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1191:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1191:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1191:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1191:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1191:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,932,674 (GRCm39) critical splice acceptor site probably null
Z1191:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1191:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1191:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1191:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1191:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1191:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,981,573 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1191:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1191:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1191:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1191:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,994,167 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 58,990,755 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,990,735 (GRCm39) missense possibly damaging 0.66
Z1192:Obscn UTSW 11 58,984,385 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,984,335 (GRCm39) missense probably benign 0.29
Z1192:Obscn UTSW 11 58,984,334 (GRCm39) missense possibly damaging 0.95
Z1192:Obscn UTSW 11 58,984,239 (GRCm39) missense possibly damaging 0.82
Z1192:Obscn UTSW 11 58,984,142 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,977,565 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,977,527 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,977,505 (GRCm39) missense probably benign 0.04
Z1192:Obscn UTSW 11 58,972,698 (GRCm39) missense possibly damaging 0.96
Z1192:Obscn UTSW 11 58,970,722 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,969,984 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 58,967,334 (GRCm39) missense possibly damaging 0.71
Z1192:Obscn UTSW 11 58,960,757 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,958,655 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,957,973 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,954,402 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 58,952,388 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,947,595 (GRCm39) missense
Z1192:Obscn UTSW 11 58,946,936 (GRCm39) missense possibly damaging 0.85
Z1192:Obscn UTSW 11 58,946,340 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,946,331 (GRCm39) missense probably damaging 0.99
Z1192:Obscn UTSW 11 58,945,176 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 59,026,505 (GRCm39) missense probably benign 0.05
Z1192:Obscn UTSW 11 58,994,364 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 59,003,380 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 59,013,563 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 59,018,892 (GRCm39) missense probably benign 0.06
Z1192:Obscn UTSW 11 59,018,895 (GRCm39) missense probably damaging 0.99
Z1192:Obscn UTSW 11 59,021,449 (GRCm39) missense probably damaging 0.98
Z1192:Obscn UTSW 11 59,023,937 (GRCm39) missense possibly damaging 0.48
Z1192:Obscn UTSW 11 58,929,976 (GRCm39) missense probably benign 0.43
Z1192:Obscn UTSW 11 58,929,990 (GRCm39) missense probably damaging 0.97
Z1192:Obscn UTSW 11 58,932,601 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,933,776 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,933,853 (GRCm39) missense probably benign 0.13
Z1192:Obscn UTSW 11 58,933,878 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,940,306 (GRCm39) missense
Z1192:Obscn UTSW 11 58,940,614 (GRCm39) missense possibly damaging 0.89
Z1192:Obscn UTSW 11 58,940,623 (GRCm39) missense
Z1192:Obscn UTSW 11 58,942,383 (GRCm39) missense probably benign 0.11
Z1192:Obscn UTSW 11 58,943,439 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,944,594 (GRCm39) missense probably benign 0.00
Z1192:Obscn UTSW 11 58,944,651 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,945,044 (GRCm39) missense probably benign
Z1192:Obscn UTSW 11 58,891,715 (GRCm39) missense probably benign 0.35
Z1192:Obscn UTSW 11 58,900,019 (GRCm39) missense probably benign 0.01
Z1192:Obscn UTSW 11 58,904,014 (GRCm39) missense probably benign 0.07
Z1192:Obscn UTSW 11 58,921,934 (GRCm39) missense probably damaging 0.97
Z1192:Obscn UTSW 11 59,024,066 (GRCm39) missense probably damaging 1.00
Z1192:Obscn UTSW 11 59,024,072 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGCCCACGAATATAGAATGG -3'
(R):5'- AGCTGGTGTTTGCCAAGGAG -3'

Sequencing Primer
(F):5'- CCCACGAATATAGAATGGCAGGAC -3'
(R):5'- TGTTTGCCAAGGAGCAGCAG -3'
Posted On 2020-08-01