Incidental Mutation 'BB001:Gcnt2'
ID 642126
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Name glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms 5330430K10Rik, IGnTB, IGnT, IGnTA, IGnTC
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 41013417-41114368 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 41072040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 228 (K228*)
Ref Sequence ENSEMBL: ENSMUSP00000066467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000225759]
AlphaFold P97402
Predicted Effect probably null
Transcript: ENSMUST00000067778
AA Change: K228*
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: K228*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069958
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000225759
AA Change: K228*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Ep300 C A 15: 81,533,703 (GRCm39) P1920Q unknown Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 41,041,339 (GRCm39) missense probably benign 0.06
IGL01693:Gcnt2 APN 13 41,041,549 (GRCm39) missense probably benign
IGL02506:Gcnt2 APN 13 41,040,856 (GRCm39) missense probably benign 0.02
IGL03184:Gcnt2 APN 13 41,041,660 (GRCm39) missense probably benign 0.01
BB011:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
PIT4472001:Gcnt2 UTSW 13 41,071,413 (GRCm39) missense probably benign 0.39
R0358:Gcnt2 UTSW 13 41,014,329 (GRCm39) missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 41,013,997 (GRCm39) missense probably benign 0.00
R1863:Gcnt2 UTSW 13 41,014,577 (GRCm39) missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 41,072,082 (GRCm39) missense probably benign 0.00
R3156:Gcnt2 UTSW 13 41,014,654 (GRCm39) missense probably benign 0.36
R3893:Gcnt2 UTSW 13 41,013,922 (GRCm39) missense probably benign 0.14
R4134:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 41,041,666 (GRCm39) missense probably benign 0.17
R4422:Gcnt2 UTSW 13 41,014,001 (GRCm39) nonsense probably null
R4599:Gcnt2 UTSW 13 41,040,966 (GRCm39) missense probably benign
R4618:Gcnt2 UTSW 13 41,111,670 (GRCm39) nonsense probably null
R4908:Gcnt2 UTSW 13 41,014,210 (GRCm39) missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 41,071,831 (GRCm39) missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 41,072,268 (GRCm39) missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 41,014,652 (GRCm39) missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 41,071,650 (GRCm39) missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 41,014,195 (GRCm39) missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 41,107,055 (GRCm39) missense probably benign 0.30
R5493:Gcnt2 UTSW 13 41,107,076 (GRCm39) missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 41,014,429 (GRCm39) missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 41,071,675 (GRCm39) missense probably benign 0.03
R6244:Gcnt2 UTSW 13 41,014,717 (GRCm39) missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 41,072,173 (GRCm39) missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 41,041,032 (GRCm39) frame shift probably null
R7077:Gcnt2 UTSW 13 41,013,896 (GRCm39) missense probably benign
R7432:Gcnt2 UTSW 13 41,040,688 (GRCm39) intron probably benign
R7474:Gcnt2 UTSW 13 41,111,733 (GRCm39) missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 41,041,157 (GRCm39) missense probably benign 0.02
R7599:Gcnt2 UTSW 13 41,014,343 (GRCm39) nonsense probably null
R7678:Gcnt2 UTSW 13 41,107,195 (GRCm39) missense probably benign 0.01
R7806:Gcnt2 UTSW 13 41,071,717 (GRCm39) missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 41,014,338 (GRCm39) missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 41,013,926 (GRCm39) missense probably benign 0.00
R7924:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
R8110:Gcnt2 UTSW 13 41,071,198 (GRCm39) start gained probably benign
R8287:Gcnt2 UTSW 13 41,014,108 (GRCm39) missense probably damaging 1.00
R8782:Gcnt2 UTSW 13 41,072,229 (GRCm39) missense probably damaging 0.98
R8956:Gcnt2 UTSW 13 41,041,204 (GRCm39) missense probably benign 0.30
R9225:Gcnt2 UTSW 13 41,014,336 (GRCm39) missense probably damaging 1.00
R9357:Gcnt2 UTSW 13 41,041,732 (GRCm39) missense possibly damaging 0.92
Z1088:Gcnt2 UTSW 13 41,072,115 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGATCTGGTGGCCTCC -3'
(R):5'- TGGAATCCTATTGAGTGTCACCC -3'

Sequencing Primer
(F):5'- TCCAAGGTCCCCTGGAAATATGTC -3'
(R):5'- GGGCTATAGGTATCTTTAGACCACTC -3'
Posted On 2020-08-01