Incidental Mutation 'BB001:Gcnt2'
ID 642126
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Name glucosaminyl (N-acetyl) transferase 2, I-branching enzyme
Synonyms IGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 40859754-40960892 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 40918564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 228 (K228*)
Ref Sequence ENSEMBL: ENSMUSP00000066467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000225759]
AlphaFold P97402
Predicted Effect probably null
Transcript: ENSMUST00000067778
AA Change: K228*
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: K228*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069958
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000225759
AA Change: K228*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik G A 16: 38,812,464 Q369* probably null Het
Acacb A G 5: 114,245,220 K2155E possibly damaging Het
Adgre5 G A 8: 83,729,400 P256S possibly damaging Het
Adipor1 T A 1: 134,425,993 V172D probably damaging Het
Ahsa1 T C 12: 87,270,456 probably null Het
Ankrd11 T C 8: 122,895,902 I404V possibly damaging Het
Asxl3 G A 18: 22,525,545 R2204Q probably damaging Het
Barhl2 A G 5: 106,457,649 S65P unknown Het
Bbx A T 16: 50,224,308 L630H probably damaging Het
Cars T C 7: 143,569,871 T531A possibly damaging Het
Catsperb T A 12: 101,520,565 H450Q probably benign Het
Cdt1 T C 8: 122,569,352 L135P probably damaging Het
Cfap206 T A 4: 34,728,833 H24L probably benign Het
Cnga4 T A 7: 105,407,821 V480E probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dlc1 T C 8: 36,571,416 R1003G probably benign Het
Dnah7b A G 1: 46,219,430 D1927G probably benign Het
Dscc1 A T 15: 55,082,176 D374E probably benign Het
Eci2 G A 13: 34,993,070 Q69* probably null Het
Ep300 C A 15: 81,649,502 P1920Q unknown Het
Epha5 A G 5: 84,084,846 Y629H possibly damaging Het
Fam208b A T 13: 3,594,331 F129Y possibly damaging Het
Fat2 G A 11: 55,262,787 T3533I probably benign Het
Fat3 T C 9: 15,999,297 N1803S probably damaging Het
Fcrls T C 3: 87,259,533 Y51C probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gucy2c A T 6: 136,763,055 V258E probably benign Het
Hecw1 C A 13: 14,322,528 L298F probably damaging Het
Hydin T G 8: 110,418,471 V818G possibly damaging Het
Hykk A G 9: 54,922,240 Y131C probably damaging Het
Ick T C 9: 78,155,464 L260P probably damaging Het
Mpo A G 11: 87,794,840 D48G probably damaging Het
Mrps10 T C 17: 47,378,283 *202Q probably null Het
Mrps14 T C 1: 160,196,989 V30A probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Muc2 G T 7: 141,695,388 G497W probably damaging Het
Nnt A T 13: 119,386,645 V237D probably damaging Het
Nox4 G T 7: 87,374,381 V492L probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr303 A G 7: 86,394,730 I256T probably damaging Het
Olfr993 T C 2: 85,414,219 Y220C probably benign Het
Pard3 A G 8: 127,410,750 N861S probably benign Het
Pdlim4 G A 11: 54,055,222 R230* probably null Het
Pinlyp C T 7: 24,542,125 V159M possibly damaging Het
Pla2g4d T C 2: 120,289,164 probably benign Het
Plcb1 A T 2: 135,359,693 T855S probably benign Het
Pot1a T A 6: 25,753,310 D409V possibly damaging Het
Prom1 T C 5: 44,029,769 D382G probably benign Het
Prss16 A T 13: 22,008,664 N83K probably damaging Het
Ptprn2 A G 12: 116,841,264 D133G probably benign Het
Rasef C T 4: 73,740,929 probably null Het
Rbak A G 5: 143,174,486 S271P probably damaging Het
Rbm20 A T 19: 53,677,585 I60F possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Serpinb3c A G 1: 107,273,174 L171P probably damaging Het
Slc25a19 T C 11: 115,615,550 Y211C unknown Het
Sorbs2 C T 8: 45,795,470 S586L probably damaging Het
Spesp1 A T 9: 62,273,451 S58R probably benign Het
Spryd3 A G 15: 102,118,327 I329T probably benign Het
St8sia2 G A 7: 73,966,952 L113F probably damaging Het
Star T C 8: 25,809,855 I75T possibly damaging Het
Tdrd6 T A 17: 43,627,806 I784F possibly damaging Het
Tsc22d4 A G 5: 137,768,011 I144V unknown Het
Tspan8 T C 10: 115,833,324 probably null Het
Ttll9 C T 2: 152,962,487 probably benign Het
Ubr4 T G 4: 139,467,276 L1160R unknown Het
Ufd1 A G 16: 18,823,285 Y162C possibly damaging Het
Unc13c A T 9: 73,734,408 F1268I probably benign Het
Uvssa T C 5: 33,410,951 I561T probably damaging Het
Vmn2r15 A T 5: 109,286,388 S817T probably damaging Het
Ybx1 T C 4: 119,282,279 E173G probably damaging Het
Zc3h6 T C 2: 129,015,480 S640P possibly damaging Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
R8782:Gcnt2 UTSW 13 40918753 missense probably damaging 0.98
R8956:Gcnt2 UTSW 13 40887728 missense probably benign 0.30
R9225:Gcnt2 UTSW 13 40860860 missense probably damaging 1.00
R9357:Gcnt2 UTSW 13 40888256 missense possibly damaging 0.92
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGATCTGGTGGCCTCC -3'
(R):5'- TGGAATCCTATTGAGTGTCACCC -3'

Sequencing Primer
(F):5'- TCCAAGGTCCCCTGGAAATATGTC -3'
(R):5'- GGGCTATAGGTATCTTTAGACCACTC -3'
Posted On 2020-08-01