Incidental Mutation 'BB001:Ep300'
ID 642129
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene Name E1A binding protein p300
Synonyms p300, KAT3B
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # BB001
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 81470329-81536278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 81533703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 1920 (P1920Q)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
AlphaFold B2RWS6
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: P1920Q
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: P1920Q

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,383,281 (GRCm39) K2155E possibly damaging Het
Adgre5 G A 8: 84,456,029 (GRCm39) P256S possibly damaging Het
Adipor1 T A 1: 134,353,731 (GRCm39) V172D probably damaging Het
Ahsa1 T C 12: 87,317,230 (GRCm39) probably null Het
Ankrd11 T C 8: 123,622,641 (GRCm39) I404V possibly damaging Het
Asxl3 G A 18: 22,658,602 (GRCm39) R2204Q probably damaging Het
Barhl2 A G 5: 106,605,515 (GRCm39) S65P unknown Het
Bbx A T 16: 50,044,671 (GRCm39) L630H probably damaging Het
Cars1 T C 7: 143,123,608 (GRCm39) T531A possibly damaging Het
Catsperb T A 12: 101,486,824 (GRCm39) H450Q probably benign Het
Cdt1 T C 8: 123,296,091 (GRCm39) L135P probably damaging Het
Cfap206 T A 4: 34,728,833 (GRCm39) H24L probably benign Het
Cilk1 T C 9: 78,062,746 (GRCm39) L260P probably damaging Het
Cnga4 T A 7: 105,057,028 (GRCm39) V480E probably benign Het
Cnot1 ACG A 8: 96,472,275 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dlc1 T C 8: 37,038,570 (GRCm39) R1003G probably benign Het
Dnah7b A G 1: 46,258,590 (GRCm39) D1927G probably benign Het
Dscc1 A T 15: 54,945,572 (GRCm39) D374E probably benign Het
Eci2 G A 13: 35,177,053 (GRCm39) Q69* probably null Het
Epha5 A G 5: 84,232,705 (GRCm39) Y629H possibly damaging Het
Fat2 G A 11: 55,153,613 (GRCm39) T3533I probably benign Het
Fat3 T C 9: 15,910,593 (GRCm39) N1803S probably damaging Het
Fcrl2 T C 3: 87,166,840 (GRCm39) Y51C probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gcnt2 A T 13: 41,072,040 (GRCm39) K228* probably null Het
Gucy2c A T 6: 136,740,053 (GRCm39) V258E probably benign Het
Hecw1 C A 13: 14,497,113 (GRCm39) L298F probably damaging Het
Hydin T G 8: 111,145,103 (GRCm39) V818G possibly damaging Het
Hykk A G 9: 54,829,524 (GRCm39) Y131C probably damaging Het
Mpo A G 11: 87,685,666 (GRCm39) D48G probably damaging Het
Mrps10 T C 17: 47,689,208 (GRCm39) *202Q probably null Het
Mrps14 T C 1: 160,024,559 (GRCm39) V30A probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Muc2 G T 7: 141,281,631 (GRCm39) G497W probably damaging Het
Nnt A T 13: 119,523,181 (GRCm39) V237D probably damaging Het
Nox4 G T 7: 87,023,589 (GRCm39) V492L probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or5ak23 T C 2: 85,244,563 (GRCm39) Y220C probably benign Het
Or6aa1 A G 7: 86,043,938 (GRCm39) I256T probably damaging Het
Pard3 A G 8: 128,137,231 (GRCm39) N861S probably benign Het
Pdlim4 G A 11: 53,946,048 (GRCm39) R230* probably null Het
Pinlyp C T 7: 24,241,550 (GRCm39) V159M possibly damaging Het
Pla2g4d T C 2: 120,119,645 (GRCm39) probably benign Het
Plcb1 A T 2: 135,201,613 (GRCm39) T855S probably benign Het
Pot1a T A 6: 25,753,309 (GRCm39) D409V possibly damaging Het
Prom1 T C 5: 44,187,111 (GRCm39) D382G probably benign Het
Prss16 A T 13: 22,192,834 (GRCm39) N83K probably damaging Het
Ptprn2 A G 12: 116,804,884 (GRCm39) D133G probably benign Het
Rasef C T 4: 73,659,166 (GRCm39) probably null Het
Rbak A G 5: 143,160,241 (GRCm39) S271P probably damaging Het
Rbm20 A T 19: 53,666,016 (GRCm39) I60F possibly damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Serpinb3c A G 1: 107,200,904 (GRCm39) L171P probably damaging Het
Slc25a19 T C 11: 115,506,376 (GRCm39) Y211C unknown Het
Sorbs2 C T 8: 46,248,507 (GRCm39) S586L probably damaging Het
Spesp1 A T 9: 62,180,733 (GRCm39) S58R probably benign Het
Spryd3 A G 15: 102,026,762 (GRCm39) I329T probably benign Het
St8sia2 G A 7: 73,616,700 (GRCm39) L113F probably damaging Het
Star T C 8: 26,299,883 (GRCm39) I75T possibly damaging Het
Tasor2 A T 13: 3,644,331 (GRCm39) F129Y possibly damaging Het
Tdrd6 T A 17: 43,938,697 (GRCm39) I784F possibly damaging Het
Tex55 G A 16: 38,632,826 (GRCm39) Q369* probably null Het
Tsc22d4 A G 5: 137,766,273 (GRCm39) I144V unknown Het
Tspan8 T C 10: 115,669,229 (GRCm39) probably null Het
Ttll9 C T 2: 152,804,407 (GRCm39) probably benign Het
Ubr4 T G 4: 139,194,587 (GRCm39) L1160R unknown Het
Ufd1 A G 16: 18,642,035 (GRCm39) Y162C possibly damaging Het
Unc13c A T 9: 73,641,690 (GRCm39) F1268I probably benign Het
Uvssa T C 5: 33,568,295 (GRCm39) I561T probably damaging Het
Vmn2r15 A T 5: 109,434,254 (GRCm39) S817T probably damaging Het
Ybx1 T C 4: 119,139,476 (GRCm39) E173G probably damaging Het
Zc3h6 T C 2: 128,857,400 (GRCm39) S640P possibly damaging Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81,525,619 (GRCm39) missense unknown
IGL01128:Ep300 APN 15 81,514,207 (GRCm39) unclassified probably benign
IGL01151:Ep300 APN 15 81,507,673 (GRCm39) intron probably benign
IGL01414:Ep300 APN 15 81,511,467 (GRCm39) unclassified probably benign
IGL01564:Ep300 APN 15 81,516,665 (GRCm39) unclassified probably benign
IGL01875:Ep300 APN 15 81,524,224 (GRCm39) missense unknown
IGL01945:Ep300 APN 15 81,500,310 (GRCm39) unclassified probably benign
IGL02022:Ep300 APN 15 81,495,638 (GRCm39) unclassified probably benign
IGL02115:Ep300 APN 15 81,533,019 (GRCm39) missense unknown
IGL02129:Ep300 APN 15 81,470,837 (GRCm39) missense unknown
IGL02145:Ep300 APN 15 81,485,367 (GRCm39) missense unknown
IGL02149:Ep300 APN 15 81,512,621 (GRCm39) unclassified probably benign
IGL02165:Ep300 APN 15 81,525,592 (GRCm39) missense probably benign 0.39
IGL02226:Ep300 APN 15 81,497,613 (GRCm39) missense unknown
IGL02610:Ep300 APN 15 81,485,723 (GRCm39) missense unknown
IGL02731:Ep300 APN 15 81,532,615 (GRCm39) missense unknown
IGL03239:Ep300 APN 15 81,525,589 (GRCm39) missense unknown
BB011:Ep300 UTSW 15 81,533,703 (GRCm39) missense unknown
R0077:Ep300 UTSW 15 81,525,514 (GRCm39) missense unknown
R0145:Ep300 UTSW 15 81,500,328 (GRCm39) critical splice donor site probably null
R0244:Ep300 UTSW 15 81,524,329 (GRCm39) missense unknown
R0390:Ep300 UTSW 15 81,524,317 (GRCm39) missense unknown
R0534:Ep300 UTSW 15 81,485,097 (GRCm39) splice site probably benign
R0671:Ep300 UTSW 15 81,500,335 (GRCm39) unclassified probably benign
R0840:Ep300 UTSW 15 81,529,134 (GRCm39) missense unknown
R1166:Ep300 UTSW 15 81,514,265 (GRCm39) unclassified probably benign
R1737:Ep300 UTSW 15 81,510,548 (GRCm39) missense probably damaging 0.99
R1893:Ep300 UTSW 15 81,515,847 (GRCm39) unclassified probably benign
R2136:Ep300 UTSW 15 81,524,648 (GRCm39) missense unknown
R3427:Ep300 UTSW 15 81,485,480 (GRCm39) missense unknown
R3757:Ep300 UTSW 15 81,532,790 (GRCm39) missense unknown
R3892:Ep300 UTSW 15 81,504,198 (GRCm39) unclassified probably benign
R4554:Ep300 UTSW 15 81,485,631 (GRCm39) missense unknown
R4575:Ep300 UTSW 15 81,495,611 (GRCm39) unclassified probably benign
R4575:Ep300 UTSW 15 81,533,210 (GRCm39) missense unknown
R4577:Ep300 UTSW 15 81,495,611 (GRCm39) unclassified probably benign
R4577:Ep300 UTSW 15 81,533,210 (GRCm39) missense unknown
R4578:Ep300 UTSW 15 81,495,611 (GRCm39) unclassified probably benign
R4578:Ep300 UTSW 15 81,533,210 (GRCm39) missense unknown
R5021:Ep300 UTSW 15 81,524,224 (GRCm39) missense unknown
R5366:Ep300 UTSW 15 81,500,301 (GRCm39) missense probably benign 0.24
R5372:Ep300 UTSW 15 81,521,031 (GRCm39) missense unknown
R5393:Ep300 UTSW 15 81,515,819 (GRCm39) unclassified probably benign
R5410:Ep300 UTSW 15 81,533,055 (GRCm39) missense unknown
R5571:Ep300 UTSW 15 81,527,418 (GRCm39) intron probably benign
R5701:Ep300 UTSW 15 81,485,696 (GRCm39) missense unknown
R5772:Ep300 UTSW 15 81,524,115 (GRCm39) intron probably benign
R5825:Ep300 UTSW 15 81,495,673 (GRCm39) missense probably benign 0.39
R5917:Ep300 UTSW 15 81,512,808 (GRCm39) unclassified probably benign
R5991:Ep300 UTSW 15 81,532,667 (GRCm39) missense unknown
R6019:Ep300 UTSW 15 81,525,583 (GRCm39) missense unknown
R6144:Ep300 UTSW 15 81,485,435 (GRCm39) missense unknown
R6291:Ep300 UTSW 15 81,532,708 (GRCm39) missense unknown
R6292:Ep300 UTSW 15 81,500,935 (GRCm39) unclassified probably benign
R6599:Ep300 UTSW 15 81,470,914 (GRCm39) missense unknown
R6804:Ep300 UTSW 15 81,525,512 (GRCm39) nonsense probably null
R6925:Ep300 UTSW 15 81,534,182 (GRCm39) missense probably benign 0.32
R7327:Ep300 UTSW 15 81,511,515 (GRCm39) missense unknown
R7378:Ep300 UTSW 15 81,534,746 (GRCm39) missense probably damaging 0.97
R7388:Ep300 UTSW 15 81,532,567 (GRCm39) missense unknown
R7419:Ep300 UTSW 15 81,532,715 (GRCm39) missense unknown
R7498:Ep300 UTSW 15 81,524,044 (GRCm39) missense unknown
R7584:Ep300 UTSW 15 81,512,627 (GRCm39) missense unknown
R7605:Ep300 UTSW 15 81,505,353 (GRCm39) missense unknown
R7619:Ep300 UTSW 15 81,492,399 (GRCm39) missense unknown
R7699:Ep300 UTSW 15 81,470,594 (GRCm39) start gained probably benign
R7763:Ep300 UTSW 15 81,470,784 (GRCm39) start gained probably benign
R7775:Ep300 UTSW 15 81,470,887 (GRCm39) missense unknown
R7778:Ep300 UTSW 15 81,470,887 (GRCm39) missense unknown
R7862:Ep300 UTSW 15 81,534,954 (GRCm39) missense probably damaging 1.00
R7924:Ep300 UTSW 15 81,533,703 (GRCm39) missense unknown
R8155:Ep300 UTSW 15 81,505,269 (GRCm39) missense unknown
R8259:Ep300 UTSW 15 81,523,218 (GRCm39) missense unknown
R8276:Ep300 UTSW 15 81,534,229 (GRCm39) missense possibly damaging 0.85
R8331:Ep300 UTSW 15 81,485,411 (GRCm39) missense unknown
R8554:Ep300 UTSW 15 81,523,228 (GRCm39) missense unknown
R9019:Ep300 UTSW 15 81,532,730 (GRCm39) missense unknown
R9128:Ep300 UTSW 15 81,533,946 (GRCm39) missense unknown
R9379:Ep300 UTSW 15 81,532,760 (GRCm39) missense unknown
R9380:Ep300 UTSW 15 81,500,245 (GRCm39) missense unknown
R9484:Ep300 UTSW 15 81,521,026 (GRCm39) missense unknown
R9659:Ep300 UTSW 15 81,505,273 (GRCm39) missense unknown
R9690:Ep300 UTSW 15 81,520,396 (GRCm39) missense unknown
R9721:Ep300 UTSW 15 81,492,516 (GRCm39) missense unknown
RF020:Ep300 UTSW 15 81,470,772 (GRCm39) start gained probably benign
Z1177:Ep300 UTSW 15 81,514,298 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGCAACGAACTGGTGTGGC -3'
(R):5'- TGGATCCAAATGCCCACCAG -3'

Sequencing Primer
(F):5'- TGCTACACCAACTACCCCTACTG -3'
(R):5'- AGGACCTCTGGCCATAGGAG -3'
Posted On 2020-08-01