Mutagenetix > Incidental Mutation

Incidental Mutation 'BB002:Kcnt2'

642141

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

BB002

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 140354509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 77 (Y77*)

Ref Sequence

ENSEMBL: ENSMUSP00000113333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably null
Transcript: ENSMUST00000119786
AA Change: Y77*

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: Y77*

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120709
AA Change: Y77*

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: Y77*

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120796
AA Change: Y77*

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: Y77*

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,994,082	Q392*	probably null	Het
4933427D14Rik	A	C	11: 72,180,501	L473V	probably benign	Het
A930002H24Rik	A	T	17: 63,863,397	V132E	unknown	Het
Abcc2	A	G	19: 43,807,112	I436V	probably benign	Het
Ahr	G	A	12: 35,515,068	Q103*	probably null	Het
Asb15	T	A	6: 24,562,724	H228Q	probably benign	Het
Asphd1	T	A	7: 126,948,456	Y225F	probably damaging	Het
Atp2c1	A	G	9: 105,442,770	M468T	possibly damaging	Het
BC030499	T	C	11: 78,291,623	L86P	probably damaging	Het
Brca1	A	G	11: 101,508,146	I1540T	probably benign	Het
Cdh20	A	T	1: 104,984,748	I576F	probably damaging	Het
Chst11	T	A	10: 83,190,954	S72T	probably damaging	Het
Cldn17	T	G	16: 88,506,645	K65N	probably damaging	Het
Cldn22	T	C	8: 47,825,187	I220T	probably benign	Het
Coasy	T	G	11: 101,083,696	D229E	probably benign	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Cpn2	G	T	16: 30,260,801	D27E	probably damaging	Het
F5	T	A	1: 164,176,366		probably null	Het
Fat3	C	T	9: 16,031,360	V1239I	possibly damaging	Het
Fbxl16	A	G	17: 25,816,906	N159S	probably benign	Het
Fhad1	A	G	4: 141,954,187	I514T	probably damaging	Het
Fras1	A	G	5: 96,781,584	K3949R	probably damaging	Het
Gm8126	A	G	14: 43,261,566	N164S	probably damaging	Het
Grm3	T	A	5: 9,589,880	E55V	probably benign	Het
Itgbl1	G	A	14: 123,973,323	D478N	possibly damaging	Het
Kdm4c	T	C	4: 74,404,821	S997P	probably damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Lrrc28	T	C	7: 67,619,109	Y71C	probably damaging	Het
Lrrc45	T	A	11: 120,715,880	W203R	probably benign	Het
Lrrc66	A	T	5: 73,608,492	C403S	possibly damaging	Het
Ly6g6e	A	T	17: 35,077,918	E45V	probably damaging	Het
Mgam	C	T	6: 40,759,051	T1574I	probably damaging	Het
Msrb2	A	T	2: 19,383,280	M80L	probably benign	Het
Musk	T	A	4: 58,367,513	L592Q	probably damaging	Het
Nlrp4a	C	A	7: 26,450,586	N539K	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr1006	T	C	2: 85,674,563	E196G		Het
Olfr1291-ps1	A	G	2: 111,499,821	S190G	probably damaging	Het
Olfr355	A	G	2: 36,927,359	F252L	possibly damaging	Het
Olfr388-ps1	A	G	11: 73,724,536	S163P	unknown	Het
Opalin	T	A	19: 41,063,803	*144C	probably null	Het
Pgam2	T	A	11: 5,803,007	H196L	possibly damaging	Het
Prrc2b	A	G	2: 32,204,115	E503G	probably damaging	Het
Prss45	T	C	9: 110,841,035	L304P	unknown	Het
Rbm20	T	A	19: 53,813,322	V87D	probably damaging	Het
Serpinb8	T	C	1: 107,598,985	L85S	probably benign	Het
Sh2b2	A	T	5: 136,224,261	H352Q	probably benign	Het
Slc6a17	T	C	3: 107,495,740	I124V	probably damaging	Het
Smim10l1	G	A	6: 133,105,582	V31M	probably damaging	Het
Snx10	T	C	6: 51,580,321	S78P	probably benign	Het
Stard10	T	C	7: 101,342,631	V187A	probably damaging	Het
Svil	C	A	18: 5,118,357	D2146E	probably benign	Het
Tsc22d4	A	G	5: 137,751,365	D301G	probably null	Het
Ube3c	T	A	5: 29,646,431	I752N	probably damaging	Het
Wisp2	G	C	2: 163,829,041	R156T	possibly damaging	Het
Wwc1	T	C	11: 35,844,163	M962V	probably benign	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- TCAGCTACCAAGAACTTCAGTAAG -3'
(R):5'- TCAAGTCTGTGGAGACATGAG -3'

Sequencing Primer
(F):5'- ATACCTTCTAAGTGCTGAAC -3'
(R):5'- GTGGAGACATGAGCCCATTTTCAAC -3'

Posted On

2020-08-01