Incidental Mutation 'BB002:F5'
ID 642142
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Name coagulation factor V
Synonyms Cf-5, Cf5
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 163979407-164047846 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 164003935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
AlphaFold O88783
Predicted Effect probably null
Transcript: ENSMUST00000086040
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164,007,093 (GRCm39) missense probably benign 0.15
IGL00843:F5 APN 1 164,039,360 (GRCm39) missense probably benign 0.00
IGL00904:F5 APN 1 164,021,578 (GRCm39) missense probably benign
IGL00913:F5 APN 1 164,032,465 (GRCm39) missense probably damaging 1.00
IGL01099:F5 APN 1 164,021,903 (GRCm39) missense probably damaging 0.99
IGL01134:F5 APN 1 164,019,548 (GRCm39) missense possibly damaging 0.87
IGL01313:F5 APN 1 164,021,181 (GRCm39) missense probably benign 0.01
IGL01635:F5 APN 1 164,035,427 (GRCm39) missense probably benign 0.00
IGL01697:F5 APN 1 164,021,621 (GRCm39) missense probably benign 0.04
IGL01768:F5 APN 1 164,003,914 (GRCm39) missense probably benign 0.22
IGL01795:F5 APN 1 164,021,959 (GRCm39) missense probably benign 0.00
IGL01835:F5 APN 1 164,021,937 (GRCm39) missense probably benign 0.12
IGL01843:F5 APN 1 164,039,395 (GRCm39) missense probably benign 0.05
IGL01989:F5 APN 1 164,003,876 (GRCm39) missense probably benign 0.39
IGL02036:F5 APN 1 164,010,571 (GRCm39) splice site probably benign
IGL02065:F5 APN 1 164,017,695 (GRCm39) missense probably damaging 1.00
IGL02077:F5 APN 1 164,026,435 (GRCm39) missense probably damaging 1.00
IGL02139:F5 APN 1 164,020,243 (GRCm39) missense possibly damaging 0.89
IGL02210:F5 APN 1 164,017,710 (GRCm39) missense probably benign 0.00
IGL02415:F5 APN 1 164,019,498 (GRCm39) missense probably damaging 1.00
IGL02440:F5 APN 1 164,034,635 (GRCm39) missense possibly damaging 0.79
IGL02471:F5 APN 1 164,001,860 (GRCm39) missense probably damaging 1.00
IGL02535:F5 APN 1 164,026,302 (GRCm39) missense probably damaging 0.98
IGL02537:F5 APN 1 164,020,686 (GRCm39) missense probably benign 0.26
IGL02628:F5 APN 1 164,021,644 (GRCm39) missense probably damaging 0.99
IGL02638:F5 APN 1 164,012,177 (GRCm39) critical splice donor site probably null
IGL02824:F5 APN 1 164,021,916 (GRCm39) missense probably benign 0.00
IGL02977:F5 APN 1 164,021,590 (GRCm39) missense probably damaging 1.00
IGL03028:F5 APN 1 164,020,569 (GRCm39) nonsense probably null
IGL03064:F5 APN 1 164,023,163 (GRCm39) missense probably benign 0.04
IGL03127:F5 APN 1 164,021,107 (GRCm39) missense probably benign 0.45
IGL03131:F5 APN 1 163,989,388 (GRCm39) missense possibly damaging 0.62
IGL03348:F5 APN 1 164,021,721 (GRCm39) missense possibly damaging 0.49
IGL03387:F5 APN 1 164,020,801 (GRCm39) missense probably damaging 1.00
James_dean UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
BB012:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R0002:F5 UTSW 1 164,029,200 (GRCm39) missense probably damaging 1.00
R0095:F5 UTSW 1 164,019,537 (GRCm39) nonsense probably null
R0116:F5 UTSW 1 164,012,483 (GRCm39) missense probably benign 0.01
R0359:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0426:F5 UTSW 1 164,010,409 (GRCm39) missense probably damaging 0.99
R0452:F5 UTSW 1 164,012,676 (GRCm39) missense probably damaging 0.99
R0457:F5 UTSW 1 164,021,769 (GRCm39) missense probably benign 0.00
R0520:F5 UTSW 1 164,037,156 (GRCm39) missense probably benign 0.15
R0522:F5 UTSW 1 164,039,332 (GRCm39) missense probably damaging 1.00
R0554:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0575:F5 UTSW 1 164,003,813 (GRCm39) missense probably damaging 1.00
R0734:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R0739:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1062:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1063:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1150:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1151:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1152:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1221:F5 UTSW 1 163,989,368 (GRCm39) missense probably damaging 1.00
R1284:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1286:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1358:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1360:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1362:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1383:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1545:F5 UTSW 1 164,036,529 (GRCm39) nonsense probably null
R1561:F5 UTSW 1 164,014,472 (GRCm39) nonsense probably null
R1623:F5 UTSW 1 164,023,191 (GRCm39) missense probably damaging 1.00
R1662:F5 UTSW 1 164,035,457 (GRCm39) missense probably damaging 1.00
R1673:F5 UTSW 1 164,007,089 (GRCm39) missense probably damaging 1.00
R1689:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1705:F5 UTSW 1 164,045,059 (GRCm39) missense possibly damaging 0.92
R1732:F5 UTSW 1 164,001,719 (GRCm39) missense probably damaging 1.00
R1763:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1774:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1799:F5 UTSW 1 164,021,100 (GRCm39) missense possibly damaging 0.58
R1800:F5 UTSW 1 164,010,403 (GRCm39) missense probably damaging 1.00
R1842:F5 UTSW 1 164,012,129 (GRCm39) missense probably damaging 0.99
R1915:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R1926:F5 UTSW 1 164,007,077 (GRCm39) missense probably damaging 1.00
R2025:F5 UTSW 1 164,037,044 (GRCm39) missense probably benign 0.05
R2198:F5 UTSW 1 164,034,603 (GRCm39) missense probably damaging 1.00
R2258:F5 UTSW 1 164,019,750 (GRCm39) missense probably damaging 1.00
R2264:F5 UTSW 1 164,021,971 (GRCm39) missense probably benign 0.32
R2281:F5 UTSW 1 164,023,289 (GRCm39) missense possibly damaging 0.80
R2407:F5 UTSW 1 164,039,441 (GRCm39) missense probably damaging 1.00
R2445:F5 UTSW 1 164,017,795 (GRCm39) missense probably damaging 1.00
R2860:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2861:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2862:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2899:F5 UTSW 1 164,014,469 (GRCm39) missense possibly damaging 0.88
R2910:F5 UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
R2912:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R2996:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R3745:F5 UTSW 1 164,014,348 (GRCm39) missense possibly damaging 0.79
R3901:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R3902:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R4365:F5 UTSW 1 164,012,519 (GRCm39) missense probably damaging 0.98
R4448:F5 UTSW 1 164,026,468 (GRCm39) missense possibly damaging 0.52
R4490:F5 UTSW 1 164,044,964 (GRCm39) missense probably benign 0.40
R4514:F5 UTSW 1 163,979,566 (GRCm39) unclassified probably benign
R4598:F5 UTSW 1 164,032,366 (GRCm39) missense probably benign 0.05
R4608:F5 UTSW 1 164,036,598 (GRCm39) missense probably benign 0.12
R4661:F5 UTSW 1 164,012,489 (GRCm39) missense probably damaging 1.00
R4667:F5 UTSW 1 164,001,755 (GRCm39) missense probably benign 0.00
R4689:F5 UTSW 1 163,979,542 (GRCm39) unclassified probably benign
R4716:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R4732:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4733:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4854:F5 UTSW 1 164,019,715 (GRCm39) missense probably damaging 1.00
R4908:F5 UTSW 1 164,039,389 (GRCm39) missense probably damaging 1.00
R4971:F5 UTSW 1 164,021,755 (GRCm39) missense probably benign
R5001:F5 UTSW 1 164,023,139 (GRCm39) missense probably benign 0.00
R5042:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R5056:F5 UTSW 1 164,019,601 (GRCm39) missense possibly damaging 0.60
R5061:F5 UTSW 1 164,021,749 (GRCm39) missense probably benign 0.00
R5143:F5 UTSW 1 164,039,397 (GRCm39) missense probably damaging 0.98
R5622:F5 UTSW 1 164,020,134 (GRCm39) missense probably benign 0.09
R5626:F5 UTSW 1 164,036,604 (GRCm39) missense probably damaging 0.98
R5658:F5 UTSW 1 164,019,907 (GRCm39) missense probably damaging 0.96
R5702:F5 UTSW 1 164,022,116 (GRCm39) nonsense probably null
R5795:F5 UTSW 1 163,979,578 (GRCm39) missense probably benign 0.09
R5884:F5 UTSW 1 164,023,215 (GRCm39) missense probably benign 0.01
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6151:F5 UTSW 1 164,017,756 (GRCm39) missense probably damaging 1.00
R6151:F5 UTSW 1 164,009,204 (GRCm39) missense probably damaging 1.00
R6345:F5 UTSW 1 164,019,520 (GRCm39) missense probably benign 0.13
R6391:F5 UTSW 1 164,021,062 (GRCm39) missense probably damaging 0.99
R6542:F5 UTSW 1 164,022,037 (GRCm39) missense probably benign 0.32
R6620:F5 UTSW 1 164,014,375 (GRCm39) missense probably damaging 1.00
R6750:F5 UTSW 1 164,021,076 (GRCm39) missense possibly damaging 0.58
R6754:F5 UTSW 1 164,021,332 (GRCm39) missense probably damaging 1.00
R6774:F5 UTSW 1 164,014,447 (GRCm39) missense probably damaging 1.00
R6802:F5 UTSW 1 164,006,925 (GRCm39) missense probably damaging 0.98
R6810:F5 UTSW 1 164,014,471 (GRCm39) missense probably damaging 1.00
R6983:F5 UTSW 1 164,021,698 (GRCm39) missense probably damaging 1.00
R7000:F5 UTSW 1 164,007,075 (GRCm39) missense probably damaging 1.00
R7151:F5 UTSW 1 164,029,230 (GRCm39) missense probably damaging 1.00
R7193:F5 UTSW 1 164,046,966 (GRCm39) missense probably damaging 1.00
R7230:F5 UTSW 1 164,012,522 (GRCm39) missense probably benign
R7324:F5 UTSW 1 164,021,150 (GRCm39) small deletion probably benign
R7350:F5 UTSW 1 164,020,277 (GRCm39) missense probably benign 0.08
R7466:F5 UTSW 1 164,020,897 (GRCm39) missense possibly damaging 0.61
R7503:F5 UTSW 1 164,019,779 (GRCm39) missense probably damaging 1.00
R7626:F5 UTSW 1 164,014,481 (GRCm39) missense possibly damaging 0.95
R7742:F5 UTSW 1 164,035,453 (GRCm39) missense possibly damaging 0.51
R7837:F5 UTSW 1 164,014,363 (GRCm39) missense probably damaging 1.00
R7848:F5 UTSW 1 163,989,446 (GRCm39) missense possibly damaging 0.94
R7925:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R8053:F5 UTSW 1 164,020,338 (GRCm39) missense probably benign 0.26
R8094:F5 UTSW 1 164,036,509 (GRCm39) missense probably benign 0.06
R8175:F5 UTSW 1 164,019,834 (GRCm39) nonsense probably null
R8209:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8226:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8266:F5 UTSW 1 164,012,693 (GRCm39) critical splice donor site probably null
R8517:F5 UTSW 1 164,003,822 (GRCm39) missense probably damaging 0.99
R8684:F5 UTSW 1 164,045,111 (GRCm39) missense probably benign 0.01
R8941:F5 UTSW 1 164,026,440 (GRCm39) missense probably benign 0.19
R9130:F5 UTSW 1 164,001,830 (GRCm39) missense probably benign 0.37
R9181:F5 UTSW 1 164,019,895 (GRCm39) missense probably benign 0.00
R9186:F5 UTSW 1 164,021,470 (GRCm39) missense probably benign
R9233:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R9314:F5 UTSW 1 164,029,146 (GRCm39) missense probably benign 0.01
R9631:F5 UTSW 1 164,014,423 (GRCm39) missense probably damaging 1.00
R9655:F5 UTSW 1 164,021,730 (GRCm39) missense probably benign 0.15
X0024:F5 UTSW 1 164,020,557 (GRCm39) missense probably damaging 1.00
Z1088:F5 UTSW 1 163,981,954 (GRCm39) missense probably benign 0.04
Z1176:F5 UTSW 1 164,012,085 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGACCTGGATAGAAGCCTATC -3'
(R):5'- CAAGGCTGTATCAAGTAAGGTTCC -3'

Sequencing Primer
(F):5'- GGACCTGGATAGAAGCCTATCTTTTC -3'
(R):5'- TGTACTTCCTGGGTAAGACAGAAATG -3'
Posted On 2020-08-01