Incidental Mutation 'BB002:Or9g4'
ID 642146
Institutional Source Beutler Lab
Gene Symbol Or9g4
Ensembl Gene ENSMUSG00000075211
Gene Name olfactory receptor family 9 subfamily G member 4
Synonyms MOR213-4, Olfr1006, GA_x6K02T2Q125-47154544-47153606
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85504555-85509085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85504907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 196 (E196G)
Ref Sequence ENSEMBL: ENSMUSP00000097501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099917] [ENSMUST00000216084]
AlphaFold A2ALD2
Predicted Effect
SMART Domains Protein: ENSMUSP00000097501
Gene: ENSMUSG00000075211
AA Change: E196G

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.3e-51 PFAM
Pfam:7tm_1 49 298 3.6e-20 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Or9g4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Or9g4 APN 2 85,504,841 (GRCm39) missense probably damaging 1.00
IGL01520:Or9g4 APN 2 85,504,701 (GRCm39) missense probably benign 0.00
IGL01939:Or9g4 APN 2 85,505,285 (GRCm39) missense probably damaging 1.00
IGL02060:Or9g4 APN 2 85,505,178 (GRCm39) missense probably benign 0.34
IGL02171:Or9g4 APN 2 85,505,285 (GRCm39) missense probably damaging 1.00
IGL03058:Or9g4 APN 2 85,505,025 (GRCm39) missense probably benign 0.00
IGL03210:Or9g4 APN 2 85,504,697 (GRCm39) missense probably damaging 1.00
BB012:Or9g4 UTSW 2 85,504,907 (GRCm39) missense
R0294:Or9g4 UTSW 2 85,505,060 (GRCm39) missense probably damaging 0.99
R1304:Or9g4 UTSW 2 85,504,682 (GRCm39) missense probably damaging 1.00
R1476:Or9g4 UTSW 2 85,505,262 (GRCm39) missense possibly damaging 0.92
R4757:Or9g4 UTSW 2 85,504,664 (GRCm39) missense probably damaging 1.00
R4793:Or9g4 UTSW 2 85,504,842 (GRCm39) missense probably damaging 1.00
R5804:Or9g4 UTSW 2 85,504,682 (GRCm39) missense probably damaging 1.00
R6146:Or9g4 UTSW 2 85,504,938 (GRCm39) nonsense probably null
R6511:Or9g4 UTSW 2 85,505,184 (GRCm39) missense possibly damaging 0.61
R6896:Or9g4 UTSW 2 85,505,277 (GRCm39) missense probably damaging 0.97
R7075:Or9g4 UTSW 2 85,505,168 (GRCm39) missense
R7344:Or9g4 UTSW 2 85,505,275 (GRCm39) nonsense probably null
R7350:Or9g4 UTSW 2 85,505,189 (GRCm39) missense
R7925:Or9g4 UTSW 2 85,504,907 (GRCm39) missense
R8704:Or9g4 UTSW 2 85,504,562 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AAGAGGGCAGCCACTTTGTC -3'
(R):5'- CTCTCTGTACTGGGCTAGTAGC -3'

Sequencing Primer
(F):5'- GGTTGAACTAGGCCTTGAATACATG -3'
(R):5'- GCTAGTAGCTGGGTGTTACATAG -3'
Posted On 2020-08-01