Incidental Mutation 'BB002:Kti12'
ID 642152
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene Name KTI12 homolog, chromatin associated
Synonyms 1110001A12Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # BB002
Quality Score 185.009
Status Not validated
Chromosome 4
Chromosomal Location 108705054-108706609 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108705443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 119 (E119A)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
AlphaFold Q9D1R2
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119A

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108,705,359 (GRCm39) missense probably damaging 1.00
IGL02891:Kti12 APN 4 108,705,730 (GRCm39) missense probably benign
IGL03142:Kti12 APN 4 108,705,362 (GRCm39) missense probably damaging 1.00
BB002:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB003:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB003:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
BB004:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB004:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
BB006:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB006:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
BB012:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB012:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
BB013:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB013:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
BB014:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB014:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
BB016:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
BB016:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R0518:Kti12 UTSW 4 108,705,776 (GRCm39) missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108,706,055 (GRCm39) missense probably damaging 1.00
R5510:Kti12 UTSW 4 108,705,821 (GRCm39) missense probably damaging 1.00
R5522:Kti12 UTSW 4 108,705,620 (GRCm39) missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108,705,730 (GRCm39) missense probably benign 0.00
R6774:Kti12 UTSW 4 108,705,652 (GRCm39) missense probably benign 0.12
R7123:Kti12 UTSW 4 108,705,679 (GRCm39) missense probably benign 0.00
R7856:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7856:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7858:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7858:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7859:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7859:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7914:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7914:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7915:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7915:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7916:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7916:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7917:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7917:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7918:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7918:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7925:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7925:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7926:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7926:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7927:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7927:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R7929:Kti12 UTSW 4 108,705,444 (GRCm39) missense probably benign 0.00
R7929:Kti12 UTSW 4 108,705,443 (GRCm39) missense probably benign
R8099:Kti12 UTSW 4 108,705,571 (GRCm39) missense probably damaging 1.00
R9516:Kti12 UTSW 4 108,705,476 (GRCm39) missense probably benign 0.00
R9567:Kti12 UTSW 4 108,705,935 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GCAGGATTTCCTCTGGATCC -3'

Sequencing Primer
(F):5'- TGGAGATCATGCCGCTCGTC -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On 2020-08-01