Incidental Mutation 'BB002:Grm3'
ID 642155
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Name glutamate receptor, metabotropic 3
Synonyms mGluR3, mGlu3, 0710001G23Rik, Gprc1c
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 9535541-9775170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9639880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 55 (E55V)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
AlphaFold Q9QYS2
Predicted Effect probably benign
Transcript: ENSMUST00000004076
AA Change: E55V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: E55V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9,562,290 (GRCm39) missense probably benign
IGL01393:Grm3 APN 5 9,639,856 (GRCm39) missense probably benign 0.00
IGL01398:Grm3 APN 5 9,535,762 (GRCm39) unclassified probably benign
IGL01825:Grm3 APN 5 9,561,600 (GRCm39) missense probably damaging 1.00
IGL01966:Grm3 APN 5 9,561,486 (GRCm39) missense probably damaging 0.98
IGL02367:Grm3 APN 5 9,561,660 (GRCm39) missense probably damaging 1.00
IGL02526:Grm3 APN 5 9,639,847 (GRCm39) missense probably damaging 1.00
IGL02972:Grm3 APN 5 9,562,410 (GRCm39) missense probably damaging 1.00
IGL03356:Grm3 APN 5 9,562,206 (GRCm39) missense possibly damaging 0.89
BB012:Grm3 UTSW 5 9,639,880 (GRCm39) missense probably benign 0.09
R0032:Grm3 UTSW 5 9,561,452 (GRCm39) splice site probably null
R0032:Grm3 UTSW 5 9,561,452 (GRCm39) splice site probably null
R0389:Grm3 UTSW 5 9,554,794 (GRCm39) missense probably damaging 1.00
R0455:Grm3 UTSW 5 9,562,477 (GRCm39) missense probably benign
R0538:Grm3 UTSW 5 9,562,446 (GRCm39) missense possibly damaging 0.95
R0553:Grm3 UTSW 5 9,620,048 (GRCm39) missense probably benign 0.16
R1124:Grm3 UTSW 5 9,620,297 (GRCm39) missense probably benign
R1163:Grm3 UTSW 5 9,620,738 (GRCm39) missense probably benign 0.34
R1440:Grm3 UTSW 5 9,639,958 (GRCm39) missense probably benign
R1635:Grm3 UTSW 5 9,561,520 (GRCm39) missense probably damaging 1.00
R1734:Grm3 UTSW 5 9,639,742 (GRCm39) missense probably benign 0.00
R1895:Grm3 UTSW 5 9,562,123 (GRCm39) missense probably damaging 1.00
R1926:Grm3 UTSW 5 9,554,881 (GRCm39) missense probably damaging 0.98
R1940:Grm3 UTSW 5 9,561,682 (GRCm39) missense probably damaging 1.00
R1946:Grm3 UTSW 5 9,562,123 (GRCm39) missense probably damaging 1.00
R2004:Grm3 UTSW 5 9,639,793 (GRCm39) missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9,639,793 (GRCm39) missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9,639,793 (GRCm39) missense possibly damaging 0.57
R3116:Grm3 UTSW 5 9,620,752 (GRCm39) missense probably damaging 1.00
R4083:Grm3 UTSW 5 9,562,054 (GRCm39) missense probably benign
R4537:Grm3 UTSW 5 9,562,083 (GRCm39) missense probably benign 0.02
R4855:Grm3 UTSW 5 9,620,047 (GRCm39) missense probably damaging 0.98
R5060:Grm3 UTSW 5 9,620,167 (GRCm39) missense probably damaging 0.99
R5093:Grm3 UTSW 5 9,639,766 (GRCm39) missense probably benign 0.01
R5419:Grm3 UTSW 5 9,620,233 (GRCm39) missense probably damaging 1.00
R5525:Grm3 UTSW 5 9,554,872 (GRCm39) missense probably damaging 1.00
R5642:Grm3 UTSW 5 9,620,536 (GRCm39) missense probably benign 0.21
R5804:Grm3 UTSW 5 9,620,155 (GRCm39) missense probably benign 0.33
R5915:Grm3 UTSW 5 9,561,927 (GRCm39) missense probably damaging 1.00
R5966:Grm3 UTSW 5 9,561,930 (GRCm39) missense probably damaging 0.98
R6151:Grm3 UTSW 5 9,561,556 (GRCm39) missense probably damaging 1.00
R6419:Grm3 UTSW 5 9,620,201 (GRCm39) missense probably damaging 1.00
R7267:Grm3 UTSW 5 9,639,581 (GRCm39) missense probably benign 0.00
R7555:Grm3 UTSW 5 9,620,000 (GRCm39) missense probably benign 0.00
R7657:Grm3 UTSW 5 9,561,452 (GRCm39) splice site probably null
R7925:Grm3 UTSW 5 9,639,880 (GRCm39) missense probably benign 0.09
R8032:Grm3 UTSW 5 9,562,272 (GRCm39) missense probably benign 0.11
R8227:Grm3 UTSW 5 9,620,242 (GRCm39) missense possibly damaging 0.65
R8462:Grm3 UTSW 5 9,562,365 (GRCm39) missense probably benign
R8500:Grm3 UTSW 5 9,561,726 (GRCm39) missense probably benign 0.21
R8696:Grm3 UTSW 5 9,562,311 (GRCm39) missense probably damaging 1.00
R8807:Grm3 UTSW 5 9,561,499 (GRCm39) missense probably damaging 1.00
R8828:Grm3 UTSW 5 9,554,725 (GRCm39) missense probably benign 0.00
R8876:Grm3 UTSW 5 9,561,580 (GRCm39) missense probably damaging 1.00
R8896:Grm3 UTSW 5 9,562,483 (GRCm39) missense possibly damaging 0.91
R9035:Grm3 UTSW 5 9,620,464 (GRCm39) missense probably damaging 0.99
R9779:Grm3 UTSW 5 9,561,656 (GRCm39) missense possibly damaging 0.74
X0020:Grm3 UTSW 5 9,562,195 (GRCm39) missense probably damaging 1.00
X0025:Grm3 UTSW 5 9,535,790 (GRCm39) missense probably damaging 1.00
X0026:Grm3 UTSW 5 9,562,238 (GRCm39) nonsense probably null
Z1088:Grm3 UTSW 5 9,620,183 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCAACGATGCTCTGACAAAC -3'
(R):5'- TTGGACCCACTCAGTGATATCTC -3'

Sequencing Primer
(F):5'- ACTCCAGTGACTGCTCTAATGCATAG -3'
(R):5'- CCACTCAGTGATATCTCCAAGAG -3'
Posted On 2020-08-01