Incidental Mutation 'BB002:Mgam'
ID 642162
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 40605765-40746057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40735985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1574 (T1574I)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: T1574I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: T1574I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: T1574I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: T1574I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202779
AA Change: T947I

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: T947I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202966
AA Change: T828I

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: T828I

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40,619,944 (GRCm39) missense probably benign
IGL01065:Mgam APN 6 40,639,644 (GRCm39) critical splice donor site probably null
IGL01402:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01404:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01413:Mgam APN 6 40,638,211 (GRCm39) missense probably damaging 1.00
IGL01546:Mgam APN 6 40,631,627 (GRCm39) missense probably damaging 0.98
IGL01596:Mgam APN 6 40,635,204 (GRCm39) missense probably damaging 1.00
IGL02133:Mgam APN 6 40,620,010 (GRCm39) missense probably damaging 0.98
IGL02734:Mgam APN 6 40,639,628 (GRCm39) missense probably damaging 1.00
BB012:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R0012:Mgam UTSW 6 40,742,190 (GRCm39) splice site probably null
R0116:Mgam UTSW 6 40,635,921 (GRCm39) missense probably damaging 1.00
R0310:Mgam UTSW 6 40,737,969 (GRCm39) splice site probably benign
R0452:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
R0497:Mgam UTSW 6 40,641,826 (GRCm39) missense probably damaging 1.00
R0699:Mgam UTSW 6 40,619,953 (GRCm39) missense possibly damaging 0.84
R0738:Mgam UTSW 6 40,731,869 (GRCm39) missense probably benign 0.01
R1033:Mgam UTSW 6 40,657,558 (GRCm39) missense probably benign 0.07
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1430:Mgam UTSW 6 40,733,305 (GRCm39) missense probably benign 0.08
R1432:Mgam UTSW 6 40,733,301 (GRCm39) missense probably damaging 1.00
R1443:Mgam UTSW 6 40,736,714 (GRCm39) nonsense probably null
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1519:Mgam UTSW 6 40,638,617 (GRCm39) missense probably benign 0.45
R1654:Mgam UTSW 6 40,734,421 (GRCm39) missense probably damaging 1.00
R1667:Mgam UTSW 6 40,653,978 (GRCm39) missense possibly damaging 0.62
R1730:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1781:Mgam UTSW 6 40,646,797 (GRCm39) missense probably damaging 1.00
R1783:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1829:Mgam UTSW 6 40,643,826 (GRCm39) missense probably damaging 1.00
R1833:Mgam UTSW 6 40,631,652 (GRCm39) critical splice donor site probably null
R1872:Mgam UTSW 6 40,638,234 (GRCm39) nonsense probably null
R1912:Mgam UTSW 6 40,741,119 (GRCm39) nonsense probably null
R1977:Mgam UTSW 6 40,641,814 (GRCm39) missense probably benign 0.01
R2048:Mgam UTSW 6 40,633,363 (GRCm39) missense possibly damaging 0.80
R2086:Mgam UTSW 6 40,737,962 (GRCm39) splice site probably null
R2138:Mgam UTSW 6 40,733,384 (GRCm39) missense probably damaging 1.00
R2224:Mgam UTSW 6 40,741,208 (GRCm39) splice site probably null
R2408:Mgam UTSW 6 40,663,456 (GRCm39) missense probably damaging 1.00
R2508:Mgam UTSW 6 40,736,717 (GRCm39) missense probably damaging 1.00
R2842:Mgam UTSW 6 40,638,279 (GRCm39) missense probably benign 0.01
R2847:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2848:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2965:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R2966:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R3035:Mgam UTSW 6 40,640,464 (GRCm39) missense probably benign
R3895:Mgam UTSW 6 40,736,054 (GRCm39) missense probably damaging 1.00
R4027:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4030:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4302:Mgam UTSW 6 40,740,019 (GRCm39) missense probably benign 0.02
R4707:Mgam UTSW 6 40,691,566 (GRCm39) splice site probably null
R4826:Mgam UTSW 6 40,657,582 (GRCm39) missense possibly damaging 0.52
R4898:Mgam UTSW 6 40,619,988 (GRCm39) missense probably benign
R5438:Mgam UTSW 6 40,661,455 (GRCm39) missense probably damaging 1.00
R5492:Mgam UTSW 6 40,733,297 (GRCm39) missense probably damaging 1.00
R5770:Mgam UTSW 6 40,646,738 (GRCm39) missense probably benign 0.01
R5839:Mgam UTSW 6 40,716,998 (GRCm39) missense possibly damaging 0.90
R5845:Mgam UTSW 6 40,652,257 (GRCm39) missense possibly damaging 0.78
R5847:Mgam UTSW 6 40,660,989 (GRCm39) missense probably benign 0.42
R5891:Mgam UTSW 6 40,721,282 (GRCm39) missense probably benign
R6158:Mgam UTSW 6 40,734,648 (GRCm39) missense probably damaging 1.00
R6193:Mgam UTSW 6 40,724,854 (GRCm39) nonsense probably null
R6423:Mgam UTSW 6 40,653,979 (GRCm39) missense possibly damaging 0.84
R6706:Mgam UTSW 6 40,721,720 (GRCm39) missense probably benign 0.00
R6813:Mgam UTSW 6 40,727,099 (GRCm39) missense probably damaging 0.99
R6863:Mgam UTSW 6 40,705,943 (GRCm39) missense probably benign 0.00
R6906:Mgam UTSW 6 40,724,853 (GRCm39) missense probably damaging 1.00
R7091:Mgam UTSW 6 40,745,210 (GRCm39) missense possibly damaging 0.95
R7099:Mgam UTSW 6 40,638,650 (GRCm39) missense probably benign 0.09
R7282:Mgam UTSW 6 40,740,045 (GRCm39) missense probably benign
R7282:Mgam UTSW 6 40,633,446 (GRCm39) missense possibly damaging 0.71
R7354:Mgam UTSW 6 40,721,732 (GRCm39) missense probably damaging 1.00
R7374:Mgam UTSW 6 40,734,373 (GRCm39) missense possibly damaging 0.89
R7399:Mgam UTSW 6 40,643,788 (GRCm39) missense probably damaging 0.99
R7406:Mgam UTSW 6 40,640,459 (GRCm39) missense probably benign 0.13
R7446:Mgam UTSW 6 40,723,266 (GRCm39) missense probably damaging 1.00
R7466:Mgam UTSW 6 40,721,723 (GRCm39) missense probably benign 0.00
R7525:Mgam UTSW 6 40,742,954 (GRCm39) missense probably benign 0.01
R7530:Mgam UTSW 6 40,686,152 (GRCm39) splice site probably null
R7570:Mgam UTSW 6 40,723,367 (GRCm39) missense probably benign 0.16
R7669:Mgam UTSW 6 40,635,944 (GRCm39) missense probably benign 0.00
R7679:Mgam UTSW 6 40,619,980 (GRCm39) missense probably damaging 0.98
R7746:Mgam UTSW 6 40,645,127 (GRCm39) missense probably damaging 0.99
R7859:Mgam UTSW 6 40,717,113 (GRCm39) missense possibly damaging 0.75
R7925:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R8206:Mgam UTSW 6 40,657,169 (GRCm39) missense probably benign 0.00
R8244:Mgam UTSW 6 40,727,520 (GRCm39) missense probably damaging 1.00
R8309:Mgam UTSW 6 40,722,111 (GRCm39) missense possibly damaging 0.88
R8472:Mgam UTSW 6 40,671,460 (GRCm39) splice site probably null
R8758:Mgam UTSW 6 40,705,977 (GRCm39) missense probably benign 0.41
R8777:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8783:Mgam UTSW 6 40,633,423 (GRCm39) missense probably damaging 0.99
R8939:Mgam UTSW 6 40,740,137 (GRCm39) critical splice donor site probably null
R8968:Mgam UTSW 6 40,734,745 (GRCm39) critical splice acceptor site probably null
R8987:Mgam UTSW 6 40,706,570 (GRCm39) missense probably damaging 1.00
R9055:Mgam UTSW 6 40,691,663 (GRCm39) intron probably benign
R9171:Mgam UTSW 6 40,745,146 (GRCm39) missense possibly damaging 0.76
R9252:Mgam UTSW 6 40,706,577 (GRCm39) missense probably damaging 0.99
R9258:Mgam UTSW 6 40,657,121 (GRCm39) missense probably benign
R9262:Mgam UTSW 6 40,723,422 (GRCm39) critical splice donor site probably null
R9287:Mgam UTSW 6 40,705,905 (GRCm39) intron probably benign
R9521:Mgam UTSW 6 40,722,118 (GRCm39) missense probably damaging 1.00
R9589:Mgam UTSW 6 40,727,519 (GRCm39) missense probably damaging 1.00
R9658:Mgam UTSW 6 40,721,311 (GRCm39) missense possibly damaging 0.93
R9784:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
RF011:Mgam UTSW 6 40,734,370 (GRCm39) missense probably damaging 1.00
RF020:Mgam UTSW 6 40,662,243 (GRCm39) missense probably damaging 1.00
RF023:Mgam UTSW 6 40,657,642 (GRCm39) missense probably benign
X0021:Mgam UTSW 6 40,635,981 (GRCm39) missense probably damaging 1.00
Z1088:Mgam UTSW 6 40,619,994 (GRCm39) missense probably benign 0.01
Z1176:Mgam UTSW 6 40,706,000 (GRCm39) missense probably damaging 1.00
Z1176:Mgam UTSW 6 40,654,578 (GRCm39) critical splice donor site probably null
Z1177:Mgam UTSW 6 40,717,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTCTCTAGATGGAATATTTC -3'
(R):5'- ACCTTCTATCCAAGATCTGTGGTATG -3'

Sequencing Primer
(F):5'- CTTGAGTCCAGTTGCAGA -3'
(R):5'- AAGAGGAAATAAAGTATTCTCTCTGC -3'
Posted On 2020-08-01