Incidental Mutation 'BB002:Stard10'
ID 642168
Institutional Source Beutler Lab
Gene Symbol Stard10
Ensembl Gene ENSMUSG00000030688
Gene Name StAR related lipid transfer domain containing 10
Synonyms Pctpl, TISP-81, PC-TP2, PCTP2, Sdccag28, CGI-52, NY-C0-28
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 100966293-100995833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100991838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000129408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032927] [ENSMUST00000163799] [ENSMUST00000164479] [ENSMUST00000172630] [ENSMUST00000173270] [ENSMUST00000210192]
AlphaFold Q9JMD3
Predicted Effect probably damaging
Transcript: ENSMUST00000032927
AA Change: V114A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032927
Gene: ENSMUSG00000030688
AA Change: V114A

DomainStartEndE-ValueType
START 21 226 8.7e-11 SMART
low complexity region 239 253 N/A INTRINSIC
low complexity region 270 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163799
AA Change: V187A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129408
Gene: ENSMUSG00000030688
AA Change: V187A

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 41 48 N/A INTRINSIC
START 94 299 8.7e-11 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164479
AA Change: V114A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133002
Gene: ENSMUSG00000030688
AA Change: V114A

DomainStartEndE-ValueType
START 21 226 8.7e-11 SMART
low complexity region 239 253 N/A INTRINSIC
low complexity region 270 284 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000127962
Gene: ENSMUSG00000030688
AA Change: V132A

DomainStartEndE-ValueType
Pfam:START 46 223 8.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172630
AA Change: V114A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134138
Gene: ENSMUSG00000030688
AA Change: V114A

DomainStartEndE-ValueType
Pfam:START 27 150 8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172662
SMART Domains Protein: ENSMUSP00000134156
Gene: ENSMUSG00000030688

DomainStartEndE-ValueType
Blast:START 35 78 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174140
Predicted Effect probably damaging
Transcript: ENSMUST00000173270
AA Change: V114A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133955
Gene: ENSMUSG00000030688
AA Change: V114A

DomainStartEndE-ValueType
Pfam:START 27 159 7.7e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133985
Gene: ENSMUSG00000030688
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
START 14 218 2.16e-6 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210192
AA Change: V114A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.8495 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered bile acid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Stard10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Stard10 APN 7 100,971,173 (GRCm39) missense probably damaging 0.98
IGL01434:Stard10 APN 7 100,971,187 (GRCm39) missense probably benign 0.43
IGL02815:Stard10 APN 7 100,993,205 (GRCm39) missense probably benign 0.12
IGL03383:Stard10 APN 7 100,991,777 (GRCm39) missense probably damaging 0.96
Ill_starred UTSW 7 100,992,343 (GRCm39) splice site probably null
BB012:Stard10 UTSW 7 100,991,838 (GRCm39) missense probably damaging 1.00
R1544:Stard10 UTSW 7 100,993,233 (GRCm39) missense probably damaging 1.00
R3891:Stard10 UTSW 7 100,993,137 (GRCm39) missense possibly damaging 0.49
R4612:Stard10 UTSW 7 100,994,877 (GRCm39) missense possibly damaging 0.70
R5715:Stard10 UTSW 7 100,971,110 (GRCm39) missense probably damaging 1.00
R6191:Stard10 UTSW 7 100,992,468 (GRCm39) missense probably damaging 0.96
R7156:Stard10 UTSW 7 100,995,258 (GRCm39) missense probably damaging 1.00
R7159:Stard10 UTSW 7 100,992,343 (GRCm39) splice site probably null
R7174:Stard10 UTSW 7 100,995,226 (GRCm39) missense probably damaging 0.96
R7719:Stard10 UTSW 7 100,995,320 (GRCm39) missense not run
R7925:Stard10 UTSW 7 100,991,838 (GRCm39) missense probably damaging 1.00
R8076:Stard10 UTSW 7 100,993,176 (GRCm39) missense probably damaging 1.00
R8939:Stard10 UTSW 7 100,991,847 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCATGATAAGAAGTGGCC -3'
(R):5'- ATGTAAGCGTGCCCAAGGAG -3'

Sequencing Primer
(F):5'- ATAAGAAGTGGCCCCTGTTC -3'
(R):5'- GAGAGCACAGCTTTCCTTCTCAG -3'
Posted On 2020-08-01