Incidental Mutation 'BB002:Wwc1'
ID 642176
Institutional Source Beutler Lab
Gene Symbol Wwc1
Ensembl Gene ENSMUSG00000018849
Gene Name WW, C2 and coiled-coil domain containing 1
Synonyms Kibra
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 35729227-35871354 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35734990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 962 (M962V)
Ref Sequence ENSEMBL: ENSMUSP00000018993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018993]
AlphaFold Q5SXA9
Predicted Effect probably benign
Transcript: ENSMUST00000018993
AA Change: M962V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000018993
Gene: ENSMUSG00000018849
AA Change: M962V

DomainStartEndE-ValueType
WW 7 39 7.96e-12 SMART
WW 54 86 5.22e-7 SMART
coiled coil region 107 133 N/A INTRINSIC
low complexity region 139 153 N/A INTRINSIC
coiled coil region 158 193 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
coiled coil region 294 330 N/A INTRINSIC
low complexity region 341 353 N/A INTRINSIC
coiled coil region 360 431 N/A INTRINSIC
low complexity region 527 549 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
Pfam:C2 674 784 8.3e-7 PFAM
low complexity region 842 860 N/A INTRINSIC
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adult synaptic plasticity and fear-based conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Other mutations in Wwc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Wwc1 APN 11 35,735,029 (GRCm39) missense possibly damaging 0.82
IGL01161:Wwc1 APN 11 35,758,103 (GRCm39) missense probably damaging 1.00
IGL01401:Wwc1 APN 11 35,789,445 (GRCm39) critical splice donor site probably null
IGL01771:Wwc1 APN 11 35,744,185 (GRCm39) critical splice donor site probably null
IGL01804:Wwc1 APN 11 35,732,751 (GRCm39) missense probably damaging 1.00
IGL02079:Wwc1 APN 11 35,766,885 (GRCm39) missense probably damaging 1.00
IGL02201:Wwc1 APN 11 35,734,978 (GRCm39) splice site probably benign
IGL03376:Wwc1 APN 11 35,743,121 (GRCm39) missense possibly damaging 0.80
IGL03403:Wwc1 APN 11 35,806,111 (GRCm39) missense possibly damaging 0.94
BB012:Wwc1 UTSW 11 35,734,990 (GRCm39) missense probably benign 0.00
P0008:Wwc1 UTSW 11 35,744,178 (GRCm39) splice site probably benign
R0277:Wwc1 UTSW 11 35,743,175 (GRCm39) missense probably damaging 0.99
R0321:Wwc1 UTSW 11 35,732,637 (GRCm39) nonsense probably null
R0323:Wwc1 UTSW 11 35,743,175 (GRCm39) missense probably damaging 0.99
R0629:Wwc1 UTSW 11 35,744,299 (GRCm39) missense probably benign 0.18
R1302:Wwc1 UTSW 11 35,734,984 (GRCm39) missense probably damaging 1.00
R1769:Wwc1 UTSW 11 35,752,671 (GRCm39) missense probably benign
R1870:Wwc1 UTSW 11 35,752,772 (GRCm39) missense probably damaging 1.00
R2000:Wwc1 UTSW 11 35,767,374 (GRCm39) missense probably damaging 1.00
R2074:Wwc1 UTSW 11 35,780,180 (GRCm39) missense possibly damaging 0.62
R2138:Wwc1 UTSW 11 35,732,714 (GRCm39) missense possibly damaging 0.47
R2140:Wwc1 UTSW 11 35,761,355 (GRCm39) missense probably benign 0.01
R2680:Wwc1 UTSW 11 35,766,756 (GRCm39) missense probably benign 0.23
R3864:Wwc1 UTSW 11 35,801,143 (GRCm39) missense probably damaging 1.00
R4773:Wwc1 UTSW 11 35,758,123 (GRCm39) missense probably benign
R4926:Wwc1 UTSW 11 35,780,227 (GRCm39) missense probably benign 0.17
R4980:Wwc1 UTSW 11 35,778,930 (GRCm39) missense possibly damaging 0.93
R4990:Wwc1 UTSW 11 35,767,393 (GRCm39) missense probably benign 0.00
R5044:Wwc1 UTSW 11 35,774,172 (GRCm39) missense probably benign 0.45
R5238:Wwc1 UTSW 11 35,766,723 (GRCm39) missense probably benign 0.02
R5421:Wwc1 UTSW 11 35,801,123 (GRCm39) missense possibly damaging 0.93
R5421:Wwc1 UTSW 11 35,766,890 (GRCm39) missense possibly damaging 0.81
R5461:Wwc1 UTSW 11 35,758,199 (GRCm39) missense probably damaging 1.00
R5705:Wwc1 UTSW 11 35,767,423 (GRCm39) missense probably damaging 0.99
R5847:Wwc1 UTSW 11 35,758,153 (GRCm39) missense probably damaging 1.00
R5993:Wwc1 UTSW 11 35,743,163 (GRCm39) missense probably benign 0.17
R6006:Wwc1 UTSW 11 35,780,100 (GRCm39) missense probably damaging 0.98
R6006:Wwc1 UTSW 11 35,761,809 (GRCm39) missense probably null 1.00
R6516:Wwc1 UTSW 11 35,758,129 (GRCm39) missense probably benign 0.05
R6519:Wwc1 UTSW 11 35,744,264 (GRCm39) missense probably benign 0.04
R6520:Wwc1 UTSW 11 35,744,264 (GRCm39) missense probably benign 0.04
R6525:Wwc1 UTSW 11 35,744,264 (GRCm39) missense probably benign 0.04
R6526:Wwc1 UTSW 11 35,744,264 (GRCm39) missense probably benign 0.04
R6527:Wwc1 UTSW 11 35,744,264 (GRCm39) missense probably benign 0.04
R6528:Wwc1 UTSW 11 35,744,264 (GRCm39) missense probably benign 0.04
R7060:Wwc1 UTSW 11 35,806,003 (GRCm39) missense possibly damaging 0.74
R7156:Wwc1 UTSW 11 35,788,201 (GRCm39) critical splice donor site probably null
R7448:Wwc1 UTSW 11 35,766,533 (GRCm39) missense probably benign
R7586:Wwc1 UTSW 11 35,735,022 (GRCm39) missense possibly damaging 0.69
R7793:Wwc1 UTSW 11 35,759,936 (GRCm39) missense probably benign 0.21
R7925:Wwc1 UTSW 11 35,734,990 (GRCm39) missense probably benign 0.00
R8296:Wwc1 UTSW 11 35,761,384 (GRCm39) splice site probably benign
R8369:Wwc1 UTSW 11 35,758,198 (GRCm39) missense probably damaging 1.00
R8735:Wwc1 UTSW 11 35,774,234 (GRCm39) missense probably damaging 1.00
R8804:Wwc1 UTSW 11 35,774,144 (GRCm39) missense probably benign 0.30
R9081:Wwc1 UTSW 11 35,782,331 (GRCm39) missense probably benign 0.12
R9281:Wwc1 UTSW 11 35,780,211 (GRCm39) missense probably benign 0.03
R9561:Wwc1 UTSW 11 35,870,796 (GRCm39) critical splice donor site probably null
R9619:Wwc1 UTSW 11 35,766,779 (GRCm39) missense probably damaging 0.98
R9713:Wwc1 UTSW 11 35,766,576 (GRCm39) missense probably benign 0.33
X0025:Wwc1 UTSW 11 35,766,867 (GRCm39) missense possibly damaging 0.95
Z1088:Wwc1 UTSW 11 35,774,309 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGCGAGAGGTGAGTGCATC -3'
(R):5'- AGGTGATCTCTTCCTGTTCCCA -3'

Sequencing Primer
(F):5'- TCCAGAGTGAACATCTGTCTG -3'
(R):5'- CTAAACCGCAGTGACAGT -3'
Posted On 2020-08-01