Incidental Mutation 'R0109:Rin3'
ID64218
Institutional Source Beutler Lab
Gene Symbol Rin3
Ensembl Gene ENSMUSG00000044456
Gene NameRas and Rab interactor 3
Synonyms
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0109 (G1)
Quality Score142
Status Not validated
Chromosome12
Chromosomal Location102283048-102390855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102313081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 50 (I50V)
Ref Sequence ENSEMBL: ENSMUSP00000123268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056950] [ENSMUST00000101114] [ENSMUST00000133820] [ENSMUST00000150795]
Predicted Effect unknown
Transcript: ENSMUST00000056950
AA Change: I50V
SMART Domains Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456
AA Change: I50V

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
low complexity region 254 311 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 579 594 N/A INTRINSIC
low complexity region 714 728 N/A INTRINSIC
VPS9 736 852 5.75e-38 SMART
RA 873 960 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101114
AA Change: I50V

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098673
Gene: ENSMUSG00000044456
AA Change: I50V

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133820
SMART Domains Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456

DomainStartEndE-ValueType
Blast:SH2 1 69 3e-39 BLAST
SCOP:d1a81a2 3 77 2e-4 SMART
low complexity region 174 231 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 368 389 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
low complexity region 634 648 N/A INTRINSIC
VPS9 656 772 5.75e-38 SMART
RA 793 880 3.5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150795
AA Change: I50V

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123268
Gene: ENSMUSG00000044456
AA Change: I50V

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
Blast:SH2 61 122 1e-38 BLAST
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary: This protein encoded by this gene is a member of the RIN family of Ras interaction-interference proteins, which are binding partners to the RAB5 small GTPases. The protein functions as a guanine nucleotide exchange for RAB5B and RAB31. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Rin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Rin3 APN 12 102373603 missense probably damaging 1.00
IGL01521:Rin3 APN 12 102369048 missense probably benign 0.00
PIT4495001:Rin3 UTSW 12 102369036 missense probably benign 0.02
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0504:Rin3 UTSW 12 102387564 nonsense probably null
R0699:Rin3 UTSW 12 102369575 missense probably damaging 0.98
R1499:Rin3 UTSW 12 102368759 missense unknown
R1733:Rin3 UTSW 12 102369330 nonsense probably null
R1743:Rin3 UTSW 12 102390096 missense possibly damaging 0.87
R2911:Rin3 UTSW 12 102373584 missense probably benign 0.43
R2961:Rin3 UTSW 12 102313046 nonsense probably null
R3153:Rin3 UTSW 12 102368541 missense unknown
R3932:Rin3 UTSW 12 102390083 missense probably damaging 0.98
R4498:Rin3 UTSW 12 102369680 missense probably damaging 1.00
R4803:Rin3 UTSW 12 102361383 intron probably benign
R4985:Rin3 UTSW 12 102368562 missense unknown
R5300:Rin3 UTSW 12 102369670 missense probably benign 0.29
R5363:Rin3 UTSW 12 102325834 missense probably damaging 0.97
R5414:Rin3 UTSW 12 102389857 nonsense probably null
R5458:Rin3 UTSW 12 102373716 missense probably damaging 0.99
R5503:Rin3 UTSW 12 102313055 missense probably benign 0.17
R5534:Rin3 UTSW 12 102387632 missense probably damaging 1.00
R5599:Rin3 UTSW 12 102389929 missense probably damaging 1.00
R5752:Rin3 UTSW 12 102313119 start gained probably benign
R5874:Rin3 UTSW 12 102389843 missense probably damaging 1.00
R6467:Rin3 UTSW 12 102369325 missense probably benign 0.06
R7250:Rin3 UTSW 12 102368634 missense unknown
R7264:Rin3 UTSW 12 102390115 missense probably benign 0.01
R7514:Rin3 UTSW 12 102369650 nonsense probably null
R7534:Rin3 UTSW 12 102350941 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGATGGGCTGACCATTTGATTC -3'
(R):5'- GCCTAGCTCCCAAAGTCAGAGAAAG -3'

Sequencing Primer
(F):5'- GGCTGACCATTTGATTCTATGTC -3'
(R):5'- AGCTGTTTGCATGAAGGCAC -3'
Posted On2013-08-06