Incidental Mutation 'BB002:Coasy'
ID 642181
Institutional Source Beutler Lab
Gene Symbol Coasy
Ensembl Gene ENSMUSG00000001755
Gene Name Coenzyme A synthase
Synonyms 1300003G02Rik, Ppat, Dpck, Ukr1
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100973391-100977445 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 100974522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 229 (D229E)
Ref Sequence ENSEMBL: ENSMUSP00000001806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001806] [ENSMUST00000017945] [ENSMUST00000019445] [ENSMUST00000107302] [ENSMUST00000107303] [ENSMUST00000107308] [ENSMUST00000149597]
AlphaFold Q9DBL7
PDB Structure Crystal structure of Bifunctional coenzyme A synthase (CoA synthase): (18044849) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001806
AA Change: D229E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001806
Gene: ENSMUSG00000001755
AA Change: D229E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_2 194 338 1.4e-11 PFAM
Pfam:CoaE 358 536 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017945
SMART Domains Protein: ENSMUSP00000017945
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
HLH 135 193 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019445
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107302
SMART Domains Protein: ENSMUSP00000102923
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
HLH 81 139 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107303
SMART Domains Protein: ENSMUSP00000102924
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
HLH 51 109 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107308
AA Change: D229E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102929
Gene: ENSMUSG00000001755
AA Change: D229E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_like 194 338 5.3e-11 PFAM
Pfam:CoaE 358 536 1.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149597
SMART Domains Protein: ENSMUSP00000121600
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:HLH 100 127 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the bifunctional protein coenzyme A (CoA) synthase which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this protein catalyzes the conversion of phosphopantetheine into dephospho-CoA while its dephospho-CoA kinase domain completes the final step by phosphorylating dephospho-CoA to form CoA. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Coasy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Coasy APN 11 100,975,184 (GRCm39) missense possibly damaging 0.76
IGL02633:Coasy APN 11 100,976,147 (GRCm39) missense probably damaging 1.00
BB012:Coasy UTSW 11 100,974,522 (GRCm39) missense probably benign
R0946:Coasy UTSW 11 100,976,696 (GRCm39) missense probably damaging 0.96
R1434:Coasy UTSW 11 100,975,822 (GRCm39) unclassified probably benign
R2269:Coasy UTSW 11 100,976,708 (GRCm39) missense probably benign 0.01
R2881:Coasy UTSW 11 100,976,675 (GRCm39) missense possibly damaging 0.90
R5037:Coasy UTSW 11 100,975,648 (GRCm39) missense probably damaging 1.00
R5791:Coasy UTSW 11 100,975,211 (GRCm39) splice site probably null
R6523:Coasy UTSW 11 100,976,944 (GRCm39) missense probably damaging 1.00
R6696:Coasy UTSW 11 100,973,927 (GRCm39) missense possibly damaging 0.68
R6931:Coasy UTSW 11 100,974,407 (GRCm39) missense probably benign
R7925:Coasy UTSW 11 100,974,522 (GRCm39) missense probably benign
R8917:Coasy UTSW 11 100,974,202 (GRCm39) missense probably benign 0.00
R9533:Coasy UTSW 11 100,975,852 (GRCm39) missense probably benign
R9773:Coasy UTSW 11 100,975,163 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTATAAGGCCGGCTTCCC -3'
(R):5'- AGAGTCCTTGGTTCCCATTTGG -3'

Sequencing Primer
(F):5'- CCGGTTGCCAGATCTCCAAG -3'
(R):5'- TTCAGTTAAAAAGTGACTGAACCCC -3'
Posted On 2020-08-01