Mutagenetix > Incidental Mutation

Incidental Mutation 'BB002:Brca1'

642182

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

BB002

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101508146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1540 (I1540T)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

AlphaFold

P48754

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: I1540T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: I1540T

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,994,082	Q392*	probably null	Het
4933427D14Rik	A	C	11: 72,180,501	L473V	probably benign	Het
A930002H24Rik	A	T	17: 63,863,397	V132E	unknown	Het
Abcc2	A	G	19: 43,807,112	I436V	probably benign	Het
Ahr	G	A	12: 35,515,068	Q103*	probably null	Het
Asb15	T	A	6: 24,562,724	H228Q	probably benign	Het
Asphd1	T	A	7: 126,948,456	Y225F	probably damaging	Het
Atp2c1	A	G	9: 105,442,770	M468T	possibly damaging	Het
BC030499	T	C	11: 78,291,623	L86P	probably damaging	Het
Cdh20	A	T	1: 104,984,748	I576F	probably damaging	Het
Chst11	T	A	10: 83,190,954	S72T	probably damaging	Het
Cldn17	T	G	16: 88,506,645	K65N	probably damaging	Het
Cldn22	T	C	8: 47,825,187	I220T	probably benign	Het
Coasy	T	G	11: 101,083,696	D229E	probably benign	Het
Colec10	T	C	15: 54,462,371	V199A	probably damaging	Het
Cpn2	G	T	16: 30,260,801	D27E	probably damaging	Het
F5	T	A	1: 164,176,366		probably null	Het
Fat3	C	T	9: 16,031,360	V1239I	possibly damaging	Het
Fbxl16	A	G	17: 25,816,906	N159S	probably benign	Het
Fhad1	A	G	4: 141,954,187	I514T	probably damaging	Het
Fras1	A	G	5: 96,781,584	K3949R	probably damaging	Het
Gm8126	A	G	14: 43,261,566	N164S	probably damaging	Het
Grm3	T	A	5: 9,589,880	E55V	probably benign	Het
Itgbl1	G	A	14: 123,973,323	D478N	possibly damaging	Het
Kcnt2	T	A	1: 140,354,509	Y77*	probably null	Het
Kdm4c	T	C	4: 74,404,821	S997P	probably damaging	Het
Kti12	A	C	4: 108,848,246	E119A	probably benign	Het
Kti12	G	T	4: 108,848,247	E119D	probably benign	Het
Lrrc28	T	C	7: 67,619,109	Y71C	probably damaging	Het
Lrrc45	T	A	11: 120,715,880	W203R	probably benign	Het
Lrrc66	A	T	5: 73,608,492	C403S	possibly damaging	Het
Ly6g6e	A	T	17: 35,077,918	E45V	probably damaging	Het
Mgam	C	T	6: 40,759,051	T1574I	probably damaging	Het
Msrb2	A	T	2: 19,383,280	M80L	probably benign	Het
Musk	T	A	4: 58,367,513	L592Q	probably damaging	Het
Nlrp4a	C	A	7: 26,450,586	N539K	probably benign	Het
Obscn	C	G	11: 59,112,555	E1306Q	probably benign	Het
Olfr1006	T	C	2: 85,674,563	E196G		Het
Olfr1291-ps1	A	G	2: 111,499,821	S190G	probably damaging	Het
Olfr355	A	G	2: 36,927,359	F252L	possibly damaging	Het
Olfr388-ps1	A	G	11: 73,724,536	S163P	unknown	Het
Opalin	T	A	19: 41,063,803	*144C	probably null	Het
Pgam2	T	A	11: 5,803,007	H196L	possibly damaging	Het
Prrc2b	A	G	2: 32,204,115	E503G	probably damaging	Het
Prss45	T	C	9: 110,841,035	L304P	unknown	Het
Rbm20	T	A	19: 53,813,322	V87D	probably damaging	Het
Serpinb8	T	C	1: 107,598,985	L85S	probably benign	Het
Sh2b2	A	T	5: 136,224,261	H352Q	probably benign	Het
Slc6a17	T	C	3: 107,495,740	I124V	probably damaging	Het
Smim10l1	G	A	6: 133,105,582	V31M	probably damaging	Het
Snx10	T	C	6: 51,580,321	S78P	probably benign	Het
Stard10	T	C	7: 101,342,631	V187A	probably damaging	Het
Svil	C	A	18: 5,118,357	D2146E	probably benign	Het
Tsc22d4	A	G	5: 137,751,365	D301G	probably null	Het
Ube3c	T	A	5: 29,646,431	I752N	probably damaging	Het
Wisp2	G	C	2: 163,829,041	R156T	possibly damaging	Het
Wwc1	T	C	11: 35,844,163	M962V	probably benign	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTCACTACTTCTTTGGGG -3'
(R):5'- TGGTACCATGCTTTCACTACTG -3'

Sequencing Primer
(F):5'- ACTCACTACTTCTTTGGGGGTCAAG -3'
(R):5'- TCTTCTTAACACAACTTAATGGGTC -3'

Posted On

2020-08-01