Incidental Mutation 'BB002:Lrrc45'
ID 642183
Institutional Source Beutler Lab
Gene Symbol Lrrc45
Ensembl Gene ENSMUSG00000025145
Gene Name leucine rich repeat containing 45
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 120604779-120611954 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120606706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 203 (W203R)
Ref Sequence ENSEMBL: ENSMUSP00000026139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026137] [ENSMUST00000026139] [ENSMUST00000055424] [ENSMUST00000106154] [ENSMUST00000106155] [ENSMUST00000145781] [ENSMUST00000151852]
AlphaFold Q8CIM1
Predicted Effect probably benign
Transcript: ENSMUST00000026137
SMART Domains Protein: ENSMUSP00000026137
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 55 107 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026139
AA Change: W203R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145
AA Change: W203R

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055424
SMART Domains Protein: ENSMUSP00000050335
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 8 78 7.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106154
SMART Domains Protein: ENSMUSP00000101760
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 44 114 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106155
SMART Domains Protein: ENSMUSP00000101761
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145781
AA Change: W203R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145
AA Change: W203R

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Lrrc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Lrrc45 APN 11 120,611,436 (GRCm39) splice site probably benign
IGL01120:Lrrc45 APN 11 120,610,836 (GRCm39) missense probably benign
IGL01536:Lrrc45 APN 11 120,606,410 (GRCm39) missense probably benign 0.01
IGL01839:Lrrc45 APN 11 120,607,975 (GRCm39) splice site probably null
IGL02190:Lrrc45 APN 11 120,609,334 (GRCm39) missense probably damaging 0.99
IGL02302:Lrrc45 APN 11 120,609,351 (GRCm39) missense possibly damaging 0.68
IGL02724:Lrrc45 APN 11 120,609,144 (GRCm39) missense probably benign 0.25
BB012:Lrrc45 UTSW 11 120,606,706 (GRCm39) missense probably benign
R0396:Lrrc45 UTSW 11 120,605,733 (GRCm39) splice site probably benign
R0420:Lrrc45 UTSW 11 120,606,045 (GRCm39) missense probably damaging 1.00
R0540:Lrrc45 UTSW 11 120,605,988 (GRCm39) nonsense probably null
R0833:Lrrc45 UTSW 11 120,609,019 (GRCm39) splice site probably null
R0942:Lrrc45 UTSW 11 120,609,064 (GRCm39) unclassified probably benign
R1252:Lrrc45 UTSW 11 120,606,297 (GRCm39) missense probably benign 0.13
R1426:Lrrc45 UTSW 11 120,610,839 (GRCm39) missense probably benign 0.00
R1543:Lrrc45 UTSW 11 120,610,844 (GRCm39) missense probably benign 0.06
R1570:Lrrc45 UTSW 11 120,610,935 (GRCm39) critical splice donor site probably null
R2392:Lrrc45 UTSW 11 120,610,365 (GRCm39) missense probably benign 0.00
R3000:Lrrc45 UTSW 11 120,609,273 (GRCm39) missense probably benign 0.00
R3930:Lrrc45 UTSW 11 120,609,503 (GRCm39) missense probably benign 0.06
R4158:Lrrc45 UTSW 11 120,609,272 (GRCm39) missense possibly damaging 0.52
R4161:Lrrc45 UTSW 11 120,609,272 (GRCm39) missense possibly damaging 0.52
R4432:Lrrc45 UTSW 11 120,606,047 (GRCm39) critical splice donor site probably null
R4647:Lrrc45 UTSW 11 120,609,947 (GRCm39) missense probably benign 0.02
R6030:Lrrc45 UTSW 11 120,611,474 (GRCm39) nonsense probably null
R6030:Lrrc45 UTSW 11 120,611,474 (GRCm39) nonsense probably null
R6220:Lrrc45 UTSW 11 120,610,353 (GRCm39) missense probably benign 0.37
R7676:Lrrc45 UTSW 11 120,611,148 (GRCm39) missense probably damaging 1.00
R7925:Lrrc45 UTSW 11 120,606,706 (GRCm39) missense probably benign
R9067:Lrrc45 UTSW 11 120,606,649 (GRCm39) missense possibly damaging 0.92
R9069:Lrrc45 UTSW 11 120,607,947 (GRCm39) missense probably benign
R9366:Lrrc45 UTSW 11 120,611,552 (GRCm39) missense probably damaging 1.00
X0026:Lrrc45 UTSW 11 120,611,058 (GRCm39) missense probably damaging 1.00
Z1088:Lrrc45 UTSW 11 120,611,057 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc45 UTSW 11 120,609,491 (GRCm39) missense possibly damaging 0.90
Z1177:Lrrc45 UTSW 11 120,609,479 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGCTGTATTAAGTTGCACCCTG -3'
(R):5'- TGAGCCACCATGCCTTAAG -3'

Sequencing Primer
(F):5'- CTGGGCTCCTGGCTATACTG -3'
(R):5'- TAAGCCCTGAACCATACCCTTCTG -3'
Posted On 2020-08-01