Incidental Mutation 'BB002:Cpn2'
ID 642188
Institutional Source Beutler Lab
Gene Symbol Cpn2
Ensembl Gene ENSMUSG00000023176
Gene Name carboxypeptidase N, polypeptide 2
Synonyms 1300018K11Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # BB002
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 30075196-30086317 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30079619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 27 (D27E)
Ref Sequence ENSEMBL: ENSMUSP00000069318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064856]
AlphaFold Q9DBB9
Predicted Effect probably damaging
Transcript: ENSMUST00000064856
AA Change: D27E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069318
Gene: ENSMUSG00000023176
AA Change: D27E

DomainStartEndE-ValueType
LRRNT 21 53 3.21e-8 SMART
LRR 96 119 1.22e2 SMART
LRR 120 143 5.11e0 SMART
LRR_TYP 144 167 2.71e-2 SMART
LRR_TYP 168 191 3.21e-4 SMART
LRR_TYP 192 215 5.9e-3 SMART
LRR_TYP 216 239 6.88e-4 SMART
LRR 240 263 6.57e-1 SMART
LRR_TYP 264 287 2.12e-4 SMART
LRR 289 311 3.07e-1 SMART
LRR_TYP 312 335 2.61e-4 SMART
LRR_TYP 336 359 5.9e-3 SMART
LRR_TYP 360 383 2.79e-4 SMART
LRRCT 395 446 7.34e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Cpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Cpn2 APN 16 30,079,338 (GRCm39) missense probably benign 0.42
IGL01954:Cpn2 APN 16 30,079,138 (GRCm39) missense probably benign 0.01
IGL02458:Cpn2 APN 16 30,079,653 (GRCm39) missense probably benign 0.00
IGL03036:Cpn2 APN 16 30,079,647 (GRCm39) missense probably benign 0.00
BB012:Cpn2 UTSW 16 30,079,619 (GRCm39) missense probably damaging 1.00
R0118:Cpn2 UTSW 16 30,079,186 (GRCm39) missense probably benign 0.04
R0541:Cpn2 UTSW 16 30,078,169 (GRCm39) missense possibly damaging 0.73
R1300:Cpn2 UTSW 16 30,078,481 (GRCm39) missense probably benign 0.01
R1470:Cpn2 UTSW 16 30,079,003 (GRCm39) missense probably benign 0.00
R1470:Cpn2 UTSW 16 30,079,003 (GRCm39) missense probably benign 0.00
R1751:Cpn2 UTSW 16 30,078,485 (GRCm39) nonsense probably null
R1753:Cpn2 UTSW 16 30,078,918 (GRCm39) missense probably damaging 1.00
R1761:Cpn2 UTSW 16 30,079,014 (GRCm39) missense probably damaging 1.00
R1767:Cpn2 UTSW 16 30,078,485 (GRCm39) nonsense probably null
R1793:Cpn2 UTSW 16 30,078,142 (GRCm39) missense probably damaging 1.00
R2360:Cpn2 UTSW 16 30,078,321 (GRCm39) missense probably benign 0.01
R2414:Cpn2 UTSW 16 30,079,392 (GRCm39) missense probably benign 0.41
R3842:Cpn2 UTSW 16 30,079,336 (GRCm39) missense probably damaging 1.00
R4934:Cpn2 UTSW 16 30,079,344 (GRCm39) missense probably damaging 1.00
R4956:Cpn2 UTSW 16 30,079,233 (GRCm39) missense possibly damaging 0.56
R5593:Cpn2 UTSW 16 30,078,898 (GRCm39) missense probably benign 0.02
R5864:Cpn2 UTSW 16 30,078,501 (GRCm39) missense probably damaging 1.00
R6755:Cpn2 UTSW 16 30,079,149 (GRCm39) missense probably damaging 1.00
R7833:Cpn2 UTSW 16 30,079,163 (GRCm39) missense probably damaging 1.00
R7925:Cpn2 UTSW 16 30,079,619 (GRCm39) missense probably damaging 1.00
R8441:Cpn2 UTSW 16 30,078,849 (GRCm39) missense probably damaging 1.00
R8679:Cpn2 UTSW 16 30,078,085 (GRCm39) missense possibly damaging 0.90
R8844:Cpn2 UTSW 16 30,078,115 (GRCm39) missense probably damaging 1.00
R9406:Cpn2 UTSW 16 30,078,360 (GRCm39) missense probably benign 0.02
R9523:Cpn2 UTSW 16 30,078,759 (GRCm39) missense possibly damaging 0.89
RF021:Cpn2 UTSW 16 30,078,156 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCTTCTCCAGTGAGCTC -3'
(R):5'- CACCGTTTAGTGATCTGGGC -3'

Sequencing Primer
(F):5'- CTCCAGTGAGCTCAGGTTAG -3'
(R):5'- TGATCTGGGCACTGCACTATGAC -3'
Posted On 2020-08-01