Incidental Mutation 'BB002:Opalin'
ID642194
Institutional Source Beutler Lab
Gene Symbol Opalin
Ensembl Gene ENSMUSG00000050121
Gene Nameoligodendrocytic myelin paranodal and inner loop protein
SynonymsTmem10, Tmp10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #BB002
Quality Score215.009
Status Not validated
Chromosome19
Chromosomal Location41062474-41077113 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 41063803 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 144 (*144C)
Ref Sequence ENSEMBL: ENSMUSP00000084422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000087176] [ENSMUST00000112200]
Predicted Effect probably benign
Transcript: ENSMUST00000051806
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087176
AA Change: *144C
SMART Domains Protein: ENSMUSP00000084422
Gene: ENSMUSG00000050121
AA Change: *144C

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112200
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Opalin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Opalin APN 19 41063800 unclassified probably benign
IGL02025:Opalin APN 19 41072235 splice site probably benign
IGL02282:Opalin APN 19 41066504 missense probably benign 0.40
IGL02878:Opalin APN 19 41067669 missense probably benign 0.19
BB012:Opalin UTSW 19 41063803 makesense probably null
R0881:Opalin UTSW 19 41063981 critical splice acceptor site probably null
R1781:Opalin UTSW 19 41067631 splice site probably null
R4579:Opalin UTSW 19 41067757 missense probably damaging 0.98
R5455:Opalin UTSW 19 41069953 missense probably benign 0.20
R5470:Opalin UTSW 19 41066531 missense probably benign 0.34
R7161:Opalin UTSW 19 41069935 missense possibly damaging 0.50
R7925:Opalin UTSW 19 41063803 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGATTACCCTGCAAGGTCTGAG -3'
(R):5'- TGTGTTCTCAAGAATCCTAGGC -3'

Sequencing Primer
(F):5'- TCTGAGATCGAATGAACCTGCCTG -3'
(R):5'- TTCTCAAGAATCCTAGGCGGTCAC -3'
Posted On2020-08-01