Incidental Mutation 'BB002:Opalin'
ID 642194
Institutional Source Beutler Lab
Gene Symbol Opalin
Ensembl Gene ENSMUSG00000050121
Gene Name oligodendrocytic myelin paranodal and inner loop protein
Synonyms Tmp10, Tmem10
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # BB002
Quality Score 215.009
Status Not validated
Chromosome 19
Chromosomal Location 41050398-41065552 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 41052242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Cysteine at position 144 (*144C)
Ref Sequence ENSEMBL: ENSMUSP00000084422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000087176] [ENSMUST00000112200]
AlphaFold Q7M750
Predicted Effect probably benign
Transcript: ENSMUST00000051806
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087176
AA Change: *144C
SMART Domains Protein: ENSMUSP00000084422
Gene: ENSMUSG00000050121
AA Change: *144C

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112200
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Cdh20 A T 1: 104,912,473 (GRCm39) I576F probably damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm8126 A G 14: 43,119,023 (GRCm39) N164S probably damaging Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Opalin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Opalin APN 19 41,052,239 (GRCm39) unclassified probably benign
IGL02025:Opalin APN 19 41,060,674 (GRCm39) splice site probably benign
IGL02282:Opalin APN 19 41,054,943 (GRCm39) missense probably benign 0.40
IGL02878:Opalin APN 19 41,056,108 (GRCm39) missense probably benign 0.19
BB012:Opalin UTSW 19 41,052,242 (GRCm39) makesense probably null
R0881:Opalin UTSW 19 41,052,420 (GRCm39) critical splice acceptor site probably null
R1781:Opalin UTSW 19 41,056,070 (GRCm39) splice site probably null
R4579:Opalin UTSW 19 41,056,196 (GRCm39) missense probably damaging 0.98
R5455:Opalin UTSW 19 41,058,392 (GRCm39) missense probably benign 0.20
R5470:Opalin UTSW 19 41,054,970 (GRCm39) missense probably benign 0.34
R7161:Opalin UTSW 19 41,058,374 (GRCm39) missense possibly damaging 0.50
R7925:Opalin UTSW 19 41,052,242 (GRCm39) makesense probably null
R9578:Opalin UTSW 19 41,060,668 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATTACCCTGCAAGGTCTGAG -3'
(R):5'- TGTGTTCTCAAGAATCCTAGGC -3'

Sequencing Primer
(F):5'- TCTGAGATCGAATGAACCTGCCTG -3'
(R):5'- TTCTCAAGAATCCTAGGCGGTCAC -3'
Posted On 2020-08-01