Incidental Mutation 'BB002:Rbm20'
ID642196
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #BB002
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53813322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 87 (V87D)
Ref Sequence ENSEMBL: ENSMUSP00000093665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]
Predicted Effect probably damaging
Transcript: ENSMUST00000095969
AA Change: V87D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: V87D

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164202
AA Change: V87D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: V87D

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGTAGACCTATGAGGCAGGGTC -3'
(R):5'- CGAAAAGGCGATTGCGGTTG -3'

Sequencing Primer
(F):5'- CCTATGAGGCAGGGTCTTGTTGAC -3'
(R):5'- AACCGAGGCAGCATGCTG -3'
Posted On2020-08-01