Incidental Mutation 'R0109:Mapk15'
ID64221
Institutional Source Beutler Lab
Gene Symbol Mapk15
Ensembl Gene ENSMUSG00000063704
Gene Namemitogen-activated protein kinase 15
Synonyms
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0109 (G1)
Quality Score124
Status Not validated
Chromosome15
Chromosomal Location75993769-75999154 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 75996077 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 153 (K153*)
Ref Sequence ENSEMBL: ENSMUSP00000087098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089669]
Predicted Effect probably null
Transcript: ENSMUST00000089669
AA Change: K153*
SMART Domains Protein: ENSMUSP00000087098
Gene: ENSMUSG00000063704
AA Change: K153*

DomainStartEndE-ValueType
S_TKc 14 305 7.08e-97 SMART
low complexity region 391 404 N/A INTRINSIC
low complexity region 424 434 N/A INTRINSIC
low complexity region 475 505 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 538 548 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161961
Predicted Effect probably benign
Transcript: ENSMUST00000230929
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Mapk15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Mapk15 APN 15 75995280 missense probably benign 0.04
IGL02075:Mapk15 APN 15 75994888 missense probably benign 0.35
IGL02395:Mapk15 APN 15 75998170 missense probably benign
IGL03052:Mapk15 UTSW 15 75993882 missense probably benign 0.01
R0008:Mapk15 UTSW 15 75998254 missense probably benign 0.08
R0109:Mapk15 UTSW 15 75996077 nonsense probably null
R1148:Mapk15 UTSW 15 75998155 missense probably benign
R1148:Mapk15 UTSW 15 75998155 missense probably benign
R2406:Mapk15 UTSW 15 75998848 missense possibly damaging 0.75
R4526:Mapk15 UTSW 15 75995255 missense possibly damaging 0.83
R4572:Mapk15 UTSW 15 75998750 splice site probably benign
R4613:Mapk15 UTSW 15 75995910 missense probably damaging 0.98
R5861:Mapk15 UTSW 15 75996359 unclassified probably benign
R6912:Mapk15 UTSW 15 75993898 missense probably damaging 0.99
R7554:Mapk15 UTSW 15 75995896 missense possibly damaging 0.63
R7620:Mapk15 UTSW 15 75998848 missense probably benign 0.00
Z1177:Mapk15 UTSW 15 75998461 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTACTGAAGGACATCCACAAGCG -3'
(R):5'- TCTCCTAATATGCAGCCCAGGCTC -3'

Sequencing Primer
(F):5'- TTACCAGCTCCTGAGAGCC -3'
(R):5'- GTTGGCCCAAGTGGGAC -3'
Posted On2013-08-06