Incidental Mutation 'BB004:Hrc'
ID642273
Institutional Source Beutler Lab
Gene Symbol Hrc
Ensembl Gene ENSMUSG00000038239
Gene Namehistidine rich calcium binding protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB004
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45335290-45338974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45336053 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 209 (H209Q)
Ref Sequence ENSEMBL: ENSMUSP00000082459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000042194] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000210541] [ENSMUST00000211067] [ENSMUST00000211327] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085351
AA Change: H209Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239
AA Change: H209Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210248
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired weight gain and weight loss around 1 year of age and increased susceptibility to induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,421,905 D37V probably damaging Het
4921539E11Rik A G 4: 103,266,342 M111T probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agrn C T 4: 156,172,809 G1188D probably damaging Het
Amz2 A G 11: 109,429,058 K90R probably damaging Het
Arhgef4 G T 1: 34,807,253 Q227H probably damaging Het
B4galt3 T A 1: 171,271,772 C10* probably null Het
Banf2 T A 2: 144,073,798 M53K probably benign Het
BC034090 A T 1: 155,241,625 L249* probably null Het
Cftr A G 6: 18,267,971 D673G possibly damaging Het
Cntnap2 G T 6: 47,095,687 C1063F possibly damaging Het
Dnah3 A G 7: 119,951,271 I296T probably damaging Het
Dpy19l2 A G 9: 24,695,901 V88A probably benign Het
Fbln5 T C 12: 101,818,388 probably benign Het
Fbn1 T C 2: 125,383,736 D532G possibly damaging Het
Fnta G A 8: 26,004,426 R258* probably null Het
Gch1 G A 14: 47,155,923 H201Y probably damaging Het
Gm13023 T A 4: 143,792,966 I99N probably benign Het
Grik2 A T 10: 49,240,794 S624T probably damaging Het
Grm5 T A 7: 88,036,174 S500T probably benign Het
Hmcn1 T A 1: 150,609,775 I4359F probably damaging Het
Hsd17b14 T C 7: 45,565,971 M164T probably damaging Het
Hydin T C 8: 110,580,844 F3952L possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc4 A G 16: 32,771,637 T958A Het
Myo19 A G 11: 84,900,220 E419G probably damaging Het
Ndufa5 A G 6: 24,527,292 V16A possibly damaging Het
Olfr714 T C 7: 107,074,289 F154L probably benign Het
Phf24 A C 4: 42,934,774 T137P probably damaging Het
Pkp4 A T 2: 59,311,754 N467I probably damaging Het
Rbm12b2 C T 4: 12,095,417 R759C possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf34 T A 5: 122,850,225 probably benign Het
Scaf8 T A 17: 3,159,220 S73T unknown Het
Scn4a T A 11: 106,342,383 E454D probably damaging Het
Serpina1e A G 12: 103,951,191 V73A probably benign Het
Sh3rf2 A G 18: 42,111,422 T350A probably benign Het
Slc35a1 A G 4: 34,669,021 V264A probably damaging Het
Slf2 A G 19: 44,935,301 K185E probably damaging Het
Spsb2 T C 6: 124,809,373 F23S probably benign Het
Ssx2ip T G 3: 146,432,610 L404R probably damaging Het
Strn4 T A 7: 16,826,631 L236Q probably null Het
Tcp10b A G 17: 13,069,692 T202A probably benign Het
Tdp1 G T 12: 99,912,296 V448L probably damaging Het
Tecrl T C 5: 83,354,819 E61G probably damaging Het
Tepp T A 8: 95,313,158 S68T probably benign Het
Trim50 T C 5: 135,353,611 F106L probably benign Het
Usp5 G T 6: 124,824,229 F224L probably benign Het
Vmn2r114 G C 17: 23,291,645 N620K probably damaging Het
Vmn2r45 C A 7: 8,483,514 M258I probably benign Het
Zfp574 T A 7: 25,080,147 V198E probably benign Het
Zmym4 A G 4: 126,905,377 I722T probably benign Het
Other mutations in Hrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03379:Hrc APN 7 45337255 missense probably benign 0.27
BB014:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R0017:Hrc UTSW 7 45336370 missense possibly damaging 0.71
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0310:Hrc UTSW 7 45336497 missense probably benign
R0436:Hrc UTSW 7 45336133 missense possibly damaging 0.53
R0534:Hrc UTSW 7 45337235 unclassified probably benign
R1230:Hrc UTSW 7 45336463 missense possibly damaging 0.85
R1808:Hrc UTSW 7 45336778 missense probably damaging 0.99
R1975:Hrc UTSW 7 45336214 missense probably damaging 0.98
R1977:Hrc UTSW 7 45336214 missense probably damaging 0.98
R2258:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R2260:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R3551:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R3552:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R4169:Hrc UTSW 7 45336757 missense probably benign 0.00
R5085:Hrc UTSW 7 45337021 missense probably damaging 0.99
R5204:Hrc UTSW 7 45335704 missense possibly damaging 0.96
R5215:Hrc UTSW 7 45336091 missense probably damaging 0.99
R5245:Hrc UTSW 7 45335431 missense probably damaging 1.00
R5390:Hrc UTSW 7 45335485 missense probably damaging 0.96
R5432:Hrc UTSW 7 45336861 missense possibly damaging 0.72
R5756:Hrc UTSW 7 45336706 missense possibly damaging 0.85
R5761:Hrc UTSW 7 45336601 splice site probably null
R5905:Hrc UTSW 7 45336234 missense probably damaging 0.99
R6144:Hrc UTSW 7 45336733 missense possibly damaging 0.86
R6684:Hrc UTSW 7 45336532 missense possibly damaging 0.53
R6699:Hrc UTSW 7 45335695 missense possibly damaging 0.85
R6809:Hrc UTSW 7 45336379 missense probably benign
R6887:Hrc UTSW 7 45335664 missense probably benign 0.18
R7178:Hrc UTSW 7 45336261 missense possibly damaging 0.53
R7208:Hrc UTSW 7 45336565 missense possibly damaging 0.53
R7258:Hrc UTSW 7 45336296 missense possibly damaging 0.70
R7310:Hrc UTSW 7 45335803 nonsense probably null
R7456:Hrc UTSW 7 45336896 missense possibly damaging 0.83
R7525:Hrc UTSW 7 45336379 missense probably benign
R7673:Hrc UTSW 7 45337234 missense probably benign 0.00
R7734:Hrc UTSW 7 45336676 missense probably benign 0.06
R7927:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R7952:Hrc UTSW 7 45336268 missense probably damaging 0.98
R8080:Hrc UTSW 7 45336838 missense probably damaging 0.96
Z1177:Hrc UTSW 7 45336970 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAGGATGGCATTGTCTCCAG -3'
(R):5'- GTGTCTGTATTCACCAGAGTCACC -3'

Sequencing Primer
(F):5'- GTGAGTATCACCGTCACGTC -3'
(R):5'- ACCAGAGTCACCGTCTTCATC -3'
Posted On2020-08-01