Incidental Mutation 'BB004:Lig4'
ID642278
Institutional Source Beutler Lab
Gene Symbol Lig4
Ensembl Gene ENSMUSG00000049717
Gene Nameligase IV, DNA, ATP-dependent
SynonymsDNA ligase IV, 5830471N16Rik, tiny
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB004
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location9969049-9977686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9973629 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 50 (H50Q)
Ref Sequence ENSEMBL: ENSMUSP00000093130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048216] [ENSMUST00000095476] [ENSMUST00000139793] [ENSMUST00000170033]
Predicted Effect probably benign
Transcript: ENSMUST00000048216
SMART Domains Protein: ENSMUSP00000036730
Gene: ENSMUSG00000040396

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Abhydrolase_5 116 299 5.6e-24 PFAM
Pfam:Abhydrolase_3 117 279 1.7e-6 PFAM
Pfam:Abhydrolase_6 117 310 4.9e-15 PFAM
Pfam:Abhydrolase_1 143 245 1.8e-8 PFAM
Pfam:AXE1 163 229 3.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095476
AA Change: H50Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: H50Q

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139793
SMART Domains Protein: ENSMUSP00000116130
Gene: ENSMUSG00000040396

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Hydrolase_4 111 250 2.5e-11 PFAM
Pfam:Abhydrolase_1 115 237 3.2e-11 PFAM
Pfam:Abhydrolase_5 116 299 6.3e-24 PFAM
Pfam:Abhydrolase_6 117 241 2.9e-8 PFAM
Pfam:AXE1 162 229 9.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170033
AA Change: H50Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: H50Q

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Meta Mutation Damage Score 0.5832 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,421,905 D37V probably damaging Het
4921539E11Rik A G 4: 103,266,342 M111T probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agrn C T 4: 156,172,809 G1188D probably damaging Het
Amz2 A G 11: 109,429,058 K90R probably damaging Het
Arhgef4 G T 1: 34,807,253 Q227H probably damaging Het
B4galt3 T A 1: 171,271,772 C10* probably null Het
Banf2 T A 2: 144,073,798 M53K probably benign Het
BC034090 A T 1: 155,241,625 L249* probably null Het
Cftr A G 6: 18,267,971 D673G possibly damaging Het
Cntnap2 G T 6: 47,095,687 C1063F possibly damaging Het
Dnah3 A G 7: 119,951,271 I296T probably damaging Het
Dpy19l2 A G 9: 24,695,901 V88A probably benign Het
Fbln5 T C 12: 101,818,388 probably benign Het
Fbn1 T C 2: 125,383,736 D532G possibly damaging Het
Fnta G A 8: 26,004,426 R258* probably null Het
Gch1 G A 14: 47,155,923 H201Y probably damaging Het
Gm13023 T A 4: 143,792,966 I99N probably benign Het
Grik2 A T 10: 49,240,794 S624T probably damaging Het
Grm5 T A 7: 88,036,174 S500T probably benign Het
Hmcn1 T A 1: 150,609,775 I4359F probably damaging Het
Hrc T A 7: 45,336,053 H209Q possibly damaging Het
Hsd17b14 T C 7: 45,565,971 M164T probably damaging Het
Hydin T C 8: 110,580,844 F3952L possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc4 A G 16: 32,771,637 T958A Het
Myo19 A G 11: 84,900,220 E419G probably damaging Het
Ndufa5 A G 6: 24,527,292 V16A possibly damaging Het
Olfr714 T C 7: 107,074,289 F154L probably benign Het
Phf24 A C 4: 42,934,774 T137P probably damaging Het
Pkp4 A T 2: 59,311,754 N467I probably damaging Het
Rbm12b2 C T 4: 12,095,417 R759C possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf34 T A 5: 122,850,225 probably benign Het
Scaf8 T A 17: 3,159,220 S73T unknown Het
Scn4a T A 11: 106,342,383 E454D probably damaging Het
Serpina1e A G 12: 103,951,191 V73A probably benign Het
Sh3rf2 A G 18: 42,111,422 T350A probably benign Het
Slc35a1 A G 4: 34,669,021 V264A probably damaging Het
Slf2 A G 19: 44,935,301 K185E probably damaging Het
Spsb2 T C 6: 124,809,373 F23S probably benign Het
Ssx2ip T G 3: 146,432,610 L404R probably damaging Het
Strn4 T A 7: 16,826,631 L236Q probably null Het
Tcp10b A G 17: 13,069,692 T202A probably benign Het
Tdp1 G T 12: 99,912,296 V448L probably damaging Het
Tecrl T C 5: 83,354,819 E61G probably damaging Het
Tepp T A 8: 95,313,158 S68T probably benign Het
Trim50 T C 5: 135,353,611 F106L probably benign Het
Usp5 G T 6: 124,824,229 F224L probably benign Het
Vmn2r114 G C 17: 23,291,645 N620K probably damaging Het
Vmn2r45 C A 7: 8,483,514 M258I probably benign Het
Zfp574 T A 7: 25,080,147 V198E probably benign Het
Zmym4 A G 4: 126,905,377 I722T probably benign Het
Other mutations in Lig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
nosegay UTSW 8 9972954 missense probably damaging 1.00
posey UTSW 8 9972955 missense probably damaging 1.00
posey2 UTSW 8 9971585 missense probably benign
BB014:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2243:Lig4 UTSW 8 9972161 missense possibly damaging 0.81
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5153:Lig4 UTSW 8 9973003 missense possibly damaging 0.95
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6312:Lig4 UTSW 8 9971739 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
R6991:Lig4 UTSW 8 9971098 missense probably damaging 0.99
R7207:Lig4 UTSW 8 9972101 nonsense probably null
R7769:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R7927:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R8113:Lig4 UTSW 8 9973485 missense probably benign 0.07
R8124:Lig4 UTSW 8 9972954 missense probably damaging 1.00
R8382:Lig4 UTSW 8 9972346 missense probably damaging 1.00
R8443:Lig4 UTSW 8 9973777 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- TTGAGGAGCTTCTGGGCATC -3'
(R):5'- TGCCACTGCCACTTAAAGTTAC -3'

Sequencing Primer
(F):5'- ATCCTTGCCTTCTCGTGGTAAG -3'
(R):5'- GCTTTATCAGTTCAAACCGGAG -3'
Posted On2020-08-01