Incidental Mutation 'R0109:Kctd16'
ID64228
Institutional Source Beutler Lab
Gene Symbol Kctd16
Ensembl Gene ENSMUSG00000051401
Gene Namepotassium channel tetramerisation domain containing 16
Synonyms4930434H12Rik, LOC383347
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R0109 (G1)
Quality Score155
Status Not validated
Chromosome18
Chromosomal Location40258361-40531168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40259151 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 264 (E264G)
Ref Sequence ENSEMBL: ENSMUSP00000089547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091927] [ENSMUST00000096572]
Predicted Effect probably benign
Transcript: ENSMUST00000091927
AA Change: E264G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089547
Gene: ENSMUSG00000051401
AA Change: E264G

DomainStartEndE-ValueType
BTB 25 130 8.7e-7 SMART
low complexity region 288 300 N/A INTRINSIC
low complexity region 374 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096572
SMART Domains Protein: ENSMUSP00000094323
Gene: ENSMUSG00000071860

DomainStartEndE-ValueType
transmembrane domain 99 121 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to reduced extinction or increase of fear memory in cued or contextual conditioning behavior tests, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Kctd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Kctd16 APN 18 40258800 missense probably benign 0.01
IGL02001:Kctd16 APN 18 40258680 missense possibly damaging 0.48
IGL02173:Kctd16 APN 18 40530853 missense probably benign 0.01
IGL03112:Kctd16 APN 18 40258800 missense probably benign 0.08
R0109:Kctd16 UTSW 18 40259151 missense probably benign 0.06
R0267:Kctd16 UTSW 18 40530877 missense probably benign 0.02
R0554:Kctd16 UTSW 18 40258439 missense probably benign
R0732:Kctd16 UTSW 18 40258563 missense probably damaging 1.00
R0883:Kctd16 UTSW 18 40530775 missense probably damaging 0.98
R2140:Kctd16 UTSW 18 40259178 missense possibly damaging 0.89
R2141:Kctd16 UTSW 18 40259178 missense possibly damaging 0.89
R2142:Kctd16 UTSW 18 40259178 missense possibly damaging 0.89
R2160:Kctd16 UTSW 18 40259085 missense probably damaging 1.00
R3723:Kctd16 UTSW 18 40258859 missense possibly damaging 0.79
R3724:Kctd16 UTSW 18 40258859 missense possibly damaging 0.79
R5483:Kctd16 UTSW 18 40530876 missense probably benign
R5589:Kctd16 UTSW 18 40259008 missense probably damaging 1.00
R5767:Kctd16 UTSW 18 40258869 missense probably benign 0.13
R5811:Kctd16 UTSW 18 40258452 missense probably damaging 1.00
R5911:Kctd16 UTSW 18 40530852 missense probably benign 0.11
R5930:Kctd16 UTSW 18 40530829 missense probably benign 0.10
R6017:Kctd16 UTSW 18 40258943 missense probably damaging 1.00
R6603:Kctd16 UTSW 18 40258491 missense probably benign
R7404:Kctd16 UTSW 18 40258773 missense probably damaging 1.00
R7597:Kctd16 UTSW 18 40530795 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGAATGAAAGTAGAGACCCCGACCG -3'
(R):5'- TCTGCACTGCCATCTAGCCAAGAC -3'

Sequencing Primer
(F):5'- AGTGTGGATTCCACATGGTG -3'
(R):5'- GTCCATTTGTGTTCAGAAAGCC -3'
Posted On2013-08-06