Incidental Mutation 'BB004:Myo19'
ID642285
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Namemyosin XIX
SynonymsMyohd1, 1110055A02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #BB004
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84880148-84911226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84900220 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 419 (E419G)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093969]
Predicted Effect probably damaging
Transcript: ENSMUST00000093969
AA Change: E419G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: E419G

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,421,905 D37V probably damaging Het
4921539E11Rik A G 4: 103,266,342 M111T probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agrn C T 4: 156,172,809 G1188D probably damaging Het
Amz2 A G 11: 109,429,058 K90R probably damaging Het
Arhgef4 G T 1: 34,807,253 Q227H probably damaging Het
B4galt3 T A 1: 171,271,772 C10* probably null Het
Banf2 T A 2: 144,073,798 M53K probably benign Het
BC034090 A T 1: 155,241,625 L249* probably null Het
Cftr A G 6: 18,267,971 D673G possibly damaging Het
Cntnap2 G T 6: 47,095,687 C1063F possibly damaging Het
Dnah3 A G 7: 119,951,271 I296T probably damaging Het
Dpy19l2 A G 9: 24,695,901 V88A probably benign Het
Fbln5 T C 12: 101,818,388 probably benign Het
Fbn1 T C 2: 125,383,736 D532G possibly damaging Het
Fnta G A 8: 26,004,426 R258* probably null Het
Gch1 G A 14: 47,155,923 H201Y probably damaging Het
Gm13023 T A 4: 143,792,966 I99N probably benign Het
Grik2 A T 10: 49,240,794 S624T probably damaging Het
Grm5 T A 7: 88,036,174 S500T probably benign Het
Hmcn1 T A 1: 150,609,775 I4359F probably damaging Het
Hrc T A 7: 45,336,053 H209Q possibly damaging Het
Hsd17b14 T C 7: 45,565,971 M164T probably damaging Het
Hydin T C 8: 110,580,844 F3952L possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc4 A G 16: 32,771,637 T958A Het
Ndufa5 A G 6: 24,527,292 V16A possibly damaging Het
Olfr714 T C 7: 107,074,289 F154L probably benign Het
Phf24 A C 4: 42,934,774 T137P probably damaging Het
Pkp4 A T 2: 59,311,754 N467I probably damaging Het
Rbm12b2 C T 4: 12,095,417 R759C possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf34 T A 5: 122,850,225 probably benign Het
Scaf8 T A 17: 3,159,220 S73T unknown Het
Scn4a T A 11: 106,342,383 E454D probably damaging Het
Serpina1e A G 12: 103,951,191 V73A probably benign Het
Sh3rf2 A G 18: 42,111,422 T350A probably benign Het
Slc35a1 A G 4: 34,669,021 V264A probably damaging Het
Slf2 A G 19: 44,935,301 K185E probably damaging Het
Spsb2 T C 6: 124,809,373 F23S probably benign Het
Ssx2ip T G 3: 146,432,610 L404R probably damaging Het
Strn4 T A 7: 16,826,631 L236Q probably null Het
Tcp10b A G 17: 13,069,692 T202A probably benign Het
Tdp1 G T 12: 99,912,296 V448L probably damaging Het
Tecrl T C 5: 83,354,819 E61G probably damaging Het
Tepp T A 8: 95,313,158 S68T probably benign Het
Trim50 T C 5: 135,353,611 F106L probably benign Het
Usp5 G T 6: 124,824,229 F224L probably benign Het
Vmn2r114 G C 17: 23,291,645 N620K probably damaging Het
Vmn2r45 C A 7: 8,483,514 M258I probably benign Het
Zfp574 T A 7: 25,080,147 V198E probably benign Het
Zmym4 A G 4: 126,905,377 I722T probably benign Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
BB014:Myo19 UTSW 11 84900220 missense probably damaging 1.00
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5083:Myo19 UTSW 11 84903211 missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84885272 splice site probably null
R5558:Myo19 UTSW 11 84910448 missense probably damaging 1.00
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6093:Myo19 UTSW 11 84885709 missense probably damaging 1.00
R6444:Myo19 UTSW 11 84895308 missense probably benign
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
R7833:Myo19 UTSW 11 84909267 missense probably benign
R7921:Myo19 UTSW 11 84908238 missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84885710 missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84900220 missense probably damaging 1.00
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Z1176:Myo19 UTSW 11 84885278 missense probably benign 0.05
Z1176:Myo19 UTSW 11 84909350 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGCCCTTCATTCAGATGTG -3'
(R):5'- TCCCAGAGGAGCATTAAGGAAC -3'

Sequencing Primer
(F):5'- CTTGCTCTGATGTAGTATGAAGCAAG -3'
(R):5'- CAAGGAACAAAGGTGCCT -3'
Posted On2020-08-01