Incidental Mutation 'R0109:Olfr1442'
ID64229
Institutional Source Beutler Lab
Gene Symbol Olfr1442
Ensembl Gene ENSMUSG00000044441
Gene Nameolfactory receptor 1442
SynonymsGA_x6K02T2RE5P-3000589-3001527, MOR202-9
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0109 (G1)
Quality Score129
Status Not validated
Chromosome19
Chromosomal Location12670439-12677277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12674860 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 218 (F218L)
Ref Sequence ENSEMBL: ENSMUSP00000146650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049724] [ENSMUST00000057924] [ENSMUST00000207341] [ENSMUST00000208494] [ENSMUST00000208657] [ENSMUST00000213486] [ENSMUST00000215134]
Predicted Effect probably benign
Transcript: ENSMUST00000049724
SMART Domains Protein: ENSMUSP00000059886
Gene: ENSMUSG00000045030

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.5e-6 PFAM
Pfam:7tm_1 39 288 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057924
AA Change: F218L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000050632
Gene: ENSMUSG00000044441
AA Change: F218L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.9e-49 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.6e-6 PFAM
Pfam:7tm_1 39 288 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207341
AA Change: F218L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000208494
AA Change: F218L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000208657
AA Change: F218L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213486
Predicted Effect probably benign
Transcript: ENSMUST00000215134
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Ppfia4 A T 1: 134,324,217 probably null Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Olfr1442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1442 APN 19 12674560 nonsense probably null
IGL00969:Olfr1442 APN 19 12674241 missense probably damaging 1.00
IGL01788:Olfr1442 APN 19 12675078 missense probably damaging 0.97
IGL02081:Olfr1442 APN 19 12674816 missense probably benign
IGL02335:Olfr1442 APN 19 12674238 missense probably damaging 0.97
IGL02383:Olfr1442 APN 19 12674535 missense probably benign 0.01
IGL02389:Olfr1442 APN 19 12674535 missense probably benign 0.00
IGL02484:Olfr1442 APN 19 12674859 missense possibly damaging 0.56
IGL02682:Olfr1442 APN 19 12674669 missense probably damaging 0.98
IGL03136:Olfr1442 APN 19 12674967 missense probably damaging 0.99
R0109:Olfr1442 UTSW 19 12674860 missense probably benign 0.02
R0112:Olfr1442 UTSW 19 12674757 missense probably benign
R4005:Olfr1442 UTSW 19 12674846 missense probably benign 0.05
R4346:Olfr1442 UTSW 19 12674228 missense probably benign 0.03
R4611:Olfr1442 UTSW 19 12674954 missense probably damaging 1.00
R5858:Olfr1442 UTSW 19 12674379 missense probably damaging 1.00
R5944:Olfr1442 UTSW 19 12674919 missense probably damaging 1.00
R6406:Olfr1442 UTSW 19 12674820 missense probably benign 0.21
R6923:Olfr1442 UTSW 19 12675045 missense possibly damaging 0.94
R7710:Olfr1442 UTSW 19 12674976 missense probably damaging 1.00
Z1176:Olfr1442 UTSW 19 12674310 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATTCCTCCATCCACACTGGGGAC -3'
(R):5'- TCCACTTGACATCAATGTGACCTGAC -3'

Sequencing Primer
(F):5'- GGGGACACATTCAGGCTTTC -3'
(R):5'- GGAGTTGCGTTACAATACCATAC -3'
Posted On2013-08-06