Incidental Mutation 'BB005:Fanci'
ID642311
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene NameFanconi anemia, complementation group I
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #BB005
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79391929-79450264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79444711 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1130 (L1130P)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000132091] [ENSMUST00000139290] [ENSMUST00000149444]
PDB Structure
Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000036865
AA Change: L1130P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: L1130P

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073889
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,538,321 W270R probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
App A T 16: 84,978,246 V501D probably benign Het
Cnot6l A G 5: 96,131,068 V97A possibly damaging Het
Cntrob A G 11: 69,300,295 L831P probably damaging Het
Dmbt1 T C 7: 131,037,890 S53P probably benign Het
Dnah2 T C 11: 69,430,835 D3833G probably damaging Het
Dock4 T C 12: 40,788,303 L1081P probably damaging Het
Dock7 T C 4: 99,001,098 N185D Het
Dsn1 T C 2: 157,006,012 probably benign Het
Evpl T C 11: 116,222,533 T1444A possibly damaging Het
Fancm A G 12: 65,106,124 D1118G unknown Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm11596 A G 11: 99,792,796 V166A unknown Het
Gm2696 A T 10: 77,814,889 T70S unknown Het
Gm5773 A G 3: 93,773,690 E223G probably damaging Het
Madd T A 2: 91,176,888 D293V probably damaging Het
Odam A G 5: 87,887,410 T78A possibly damaging Het
Olfr629 T A 7: 103,741,190 I17F probably damaging Het
Rassf3 A G 10: 121,417,079 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhbdf1 T C 11: 32,209,898 Y826C possibly damaging Het
Rnf13 C A 3: 57,764,308 Q14K probably benign Het
Sec13 A G 6: 113,729,640 S271P probably damaging Het
Sema6c T C 3: 95,172,309 L638P probably damaging Het
Sgsh T G 11: 119,347,735 H301P probably benign Het
Shh T C 5: 28,461,406 M161V possibly damaging Het
Stil C T 4: 115,030,001 H764Y probably damaging Het
Vmn1r203 C T 13: 22,524,535 T162I probably benign Het
Zfp950 G T 19: 61,119,500 P382T probably damaging Het
Zzef1 T C 11: 72,821,896 M214T probably damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79412700 missense probably damaging 1.00
IGL00718:Fanci APN 7 79444174 missense possibly damaging 0.92
IGL00764:Fanci APN 7 79395912 start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79449177 missense probably benign 0.01
IGL02338:Fanci APN 7 79433531 nonsense probably null
IGL02428:Fanci APN 7 79444516 intron probably benign
IGL03029:Fanci APN 7 79443999 missense probably benign 0.00
BB015:Fanci UTSW 7 79444711 missense probably benign
P0023:Fanci UTSW 7 79402300 missense probably benign 0.00
P0047:Fanci UTSW 7 79444044 missense probably damaging 1.00
R0310:Fanci UTSW 7 79407417 splice site probably benign
R0388:Fanci UTSW 7 79439630 missense probably benign
R0506:Fanci UTSW 7 79432178 missense probably benign 0.29
R0570:Fanci UTSW 7 79443963 missense probably damaging 1.00
R0631:Fanci UTSW 7 79406205 missense probably damaging 1.00
R0746:Fanci UTSW 7 79439681 missense probably damaging 0.99
R0981:Fanci UTSW 7 79405166 missense probably benign 0.01
R1559:Fanci UTSW 7 79433193 missense probably damaging 1.00
R1656:Fanci UTSW 7 79405188 splice site probably benign
R1748:Fanci UTSW 7 79430488 missense probably damaging 1.00
R1815:Fanci UTSW 7 79438308 missense probably damaging 1.00
R2164:Fanci UTSW 7 79395995 missense probably benign 0.22
R3508:Fanci UTSW 7 79433472 missense probably benign 0.01
R3908:Fanci UTSW 7 79433509 missense possibly damaging 0.91
R4036:Fanci UTSW 7 79444822 missense probably damaging 1.00
R4066:Fanci UTSW 7 79412757 critical splice donor site probably null
R4633:Fanci UTSW 7 79427242 missense probably damaging 1.00
R4651:Fanci UTSW 7 79435256 missense possibly damaging 0.74
R4993:Fanci UTSW 7 79435378 makesense probably null
R5341:Fanci UTSW 7 79406178 missense probably damaging 1.00
R5806:Fanci UTSW 7 79448848 missense probably damaging 0.97
R5898:Fanci UTSW 7 79433321 missense probably benign
R5919:Fanci UTSW 7 79444738 missense probably damaging 1.00
R5960:Fanci UTSW 7 79443762 missense probably damaging 1.00
R6367:Fanci UTSW 7 79426195 missense probably damaging 0.99
R6436:Fanci UTSW 7 79440698 missense probably benign 0.03
R6468:Fanci UTSW 7 79417939 missense probably benign 0.10
R6508:Fanci UTSW 7 79443768 missense probably damaging 0.99
R6886:Fanci UTSW 7 79420342 missense possibly damaging 0.81
R7554:Fanci UTSW 7 79412752 missense probably damaging 0.99
R7588:Fanci UTSW 7 79434269 missense possibly damaging 0.81
R7644:Fanci UTSW 7 79444471 nonsense probably null
R7697:Fanci UTSW 7 79406292 critical splice donor site probably null
R7732:Fanci UTSW 7 79412652 missense possibly damaging 0.65
R7928:Fanci UTSW 7 79444711 missense probably benign
R8170:Fanci UTSW 7 79433557 splice site probably null
R8355:Fanci UTSW 7 79435281 missense probably damaging 1.00
R8425:Fanci UTSW 7 79433541 missense probably benign 0.07
R8429:Fanci UTSW 7 79438385 missense possibly damaging 0.65
R8455:Fanci UTSW 7 79435281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGATTGTAAGGCCAAC -3'
(R):5'- ACTGTGAATCTGGCCTGTGG -3'

Sequencing Primer
(F):5'- AAGGCCACCAAAATGTCAGTG -3'
(R):5'- GTGGGACCTGATTATCTCCCAAG -3'
Posted On2020-08-01