Mutagenetix > Incidental Mutation

Incidental Mutation 'BB005:Dmbt1'

642313

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

BB005

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130633787-130723357 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130639620 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 53 (S53P)

Ref Sequence

ENSEMBL: ENSMUSP00000148657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084509

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208311

Predicted Effect

probably benign
Transcript: ENSMUST00000213064
AA Change: S53P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	A	15: 74,410,170 (GRCm39)	W270R	probably damaging	Het
Adprhl1	C	T	8: 13,298,682 (GRCm39)	V83I	probably damaging	Het
App	A	T	16: 84,775,134 (GRCm39)	V501D	probably benign	Het
Cnot6l	A	G	5: 96,278,927 (GRCm39)	V97A	possibly damaging	Het
Cntrob	A	G	11: 69,191,121 (GRCm39)	L831P	probably damaging	Het
Dnah2	T	C	11: 69,321,661 (GRCm39)	D3833G	probably damaging	Het
Dock4	T	C	12: 40,838,302 (GRCm39)	L1081P	probably damaging	Het
Dock7	T	C	4: 98,889,335 (GRCm39)	N185D		Het
Dsn1	T	C	2: 156,847,932 (GRCm39)		probably benign	Het
Evpl	T	C	11: 116,113,359 (GRCm39)	T1444A	possibly damaging	Het
Fanci	T	C	7: 79,094,459 (GRCm39)	L1130P	probably benign	Het
Fancm	A	G	12: 65,152,898 (GRCm39)	D1118G	unknown	Het
G530012D18Rik	C	G	1: 85,504,935 (GRCm39)	D113E	unknown	Het
Gm11596	A	G	11: 99,683,622 (GRCm39)	V166A	unknown	Het
Gm2696	A	T	10: 77,650,723 (GRCm39)	T70S	unknown	Het
Gm5773	A	G	3: 93,680,997 (GRCm39)	E223G	probably damaging	Het
Madd	T	A	2: 91,007,233 (GRCm39)	D293V	probably damaging	Het
Odam	A	G	5: 88,035,269 (GRCm39)	T78A	possibly damaging	Het
Or52ae9	T	A	7: 103,390,397 (GRCm39)	I17F	probably damaging	Het
Rassf3	A	G	10: 121,252,984 (GRCm39)		probably null	Het
Rftn1	G	T	17: 50,354,408 (GRCm39)	A318D	probably damaging	Het
Rhbdf1	T	C	11: 32,159,898 (GRCm39)	Y826C	possibly damaging	Het
Rnf13	C	A	3: 57,671,729 (GRCm39)	Q14K	probably benign	Het
Sec13	A	G	6: 113,706,601 (GRCm39)	S271P	probably damaging	Het
Sema6c	T	C	3: 95,079,620 (GRCm39)	L638P	probably damaging	Het
Sgsh	T	G	11: 119,238,561 (GRCm39)	H301P	probably benign	Het
Shh	T	C	5: 28,666,404 (GRCm39)	M161V	possibly damaging	Het
Stil	C	T	4: 114,887,198 (GRCm39)	H764Y	probably damaging	Het
Vmn1r203	C	T	13: 22,708,705 (GRCm39)	T162I	probably benign	Het
Zfp950	G	T	19: 61,107,938 (GRCm39)	P382T	probably damaging	Het
Zzef1	T	C	11: 72,712,722 (GRCm39)	M214T	probably damaging	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	130,681,270 (GRCm39)	intron	probably benign
IGL00161:Dmbt1	APN	7	130,711,357 (GRCm39)	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	130,701,020 (GRCm39)	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	130,684,230 (GRCm39)	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	130,699,337 (GRCm39)	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	130,659,888 (GRCm39)	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	130,687,098 (GRCm39)	splice site	probably benign
IGL01317:Dmbt1	APN	7	130,642,921 (GRCm39)	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	130,690,497 (GRCm39)	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	130,705,409 (GRCm39)	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	130,718,457 (GRCm39)	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	130,682,915 (GRCm39)	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	130,676,149 (GRCm39)	intron	probably benign
IGL02160:Dmbt1	APN	7	130,684,418 (GRCm39)	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	130,694,986 (GRCm39)	splice site	probably benign
IGL02197:Dmbt1	APN	7	130,687,152 (GRCm39)	splice site	probably benign
IGL02332:Dmbt1	APN	7	130,668,343 (GRCm39)	intron	probably benign
IGL02427:Dmbt1	APN	7	130,689,815 (GRCm39)	splice site	probably null
IGL02726:Dmbt1	APN	7	130,676,140 (GRCm39)	intron	probably benign
IGL02967:Dmbt1	APN	7	130,672,919 (GRCm39)	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	130,684,409 (GRCm39)	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	130,712,778 (GRCm39)	missense	probably damaging	0.99
cavity	UTSW	7	130,713,965 (GRCm39)	missense	unknown
lacunar	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
BB015:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	130,713,805 (GRCm39)	nonsense	probably null
K3955:Dmbt1	UTSW	7	130,721,293 (GRCm39)	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	130,708,123 (GRCm39)	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	130,697,779 (GRCm39)	splice site	probably benign
R0427:Dmbt1	UTSW	7	130,642,632 (GRCm39)	nonsense	probably null
R0478:Dmbt1	UTSW	7	130,642,917 (GRCm39)	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	130,699,403 (GRCm39)	splice site	probably null
R0538:Dmbt1	UTSW	7	130,651,631 (GRCm39)	splice site	probably benign
R0626:Dmbt1	UTSW	7	130,703,811 (GRCm39)	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	130,699,383 (GRCm39)	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	130,694,847 (GRCm39)	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	130,676,254 (GRCm39)	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	130,651,944 (GRCm39)	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	130,646,217 (GRCm39)	splice site	probably benign
R1463:Dmbt1	UTSW	7	130,711,366 (GRCm39)	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	130,676,061 (GRCm39)	intron	probably benign
R1990:Dmbt1	UTSW	7	130,660,018 (GRCm39)	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	130,708,089 (GRCm39)	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	130,700,863 (GRCm39)	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	130,651,748 (GRCm39)	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	130,703,762 (GRCm39)	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	130,699,305 (GRCm39)	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	130,648,292 (GRCm39)	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	130,692,224 (GRCm39)	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	130,708,198 (GRCm39)	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	130,696,464 (GRCm39)	nonsense	probably null
R3014:Dmbt1	UTSW	7	130,633,827 (GRCm39)	intron	probably benign
R3155:Dmbt1	UTSW	7	130,651,887 (GRCm39)	nonsense	probably null
R3176:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	130,707,979 (GRCm39)	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	130,713,819 (GRCm39)	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	130,675,932 (GRCm39)	intron	probably benign
R4396:Dmbt1	UTSW	7	130,718,361 (GRCm39)	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	130,642,664 (GRCm39)	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	130,651,742 (GRCm39)	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	130,696,472 (GRCm39)	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	130,699,400 (GRCm39)	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	130,696,465 (GRCm39)	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	130,684,349 (GRCm39)	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	130,642,751 (GRCm39)	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	130,721,240 (GRCm39)	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	130,642,723 (GRCm39)	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	130,665,133 (GRCm39)	intron	probably benign
R5526:Dmbt1	UTSW	7	130,642,920 (GRCm39)	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	130,701,030 (GRCm39)	nonsense	probably null
R5566:Dmbt1	UTSW	7	130,708,003 (GRCm39)	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	130,655,797 (GRCm39)	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	130,711,370 (GRCm39)	splice site	probably null
R6188:Dmbt1	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	130,705,308 (GRCm39)	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	130,718,370 (GRCm39)	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	130,648,240 (GRCm39)	splice site	probably null
R6719:Dmbt1	UTSW	7	130,721,332 (GRCm39)	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	130,648,291 (GRCm39)	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	130,668,464 (GRCm39)	nonsense	probably null
R7191:Dmbt1	UTSW	7	130,646,250 (GRCm39)	missense	unknown
R7269:Dmbt1	UTSW	7	130,668,351 (GRCm39)	missense	unknown
R7288:Dmbt1	UTSW	7	130,685,519 (GRCm39)	nonsense	probably null
R7296:Dmbt1	UTSW	7	130,713,861 (GRCm39)	missense	unknown
R7349:Dmbt1	UTSW	7	130,642,854 (GRCm39)	missense	unknown
R7386:Dmbt1	UTSW	7	130,713,965 (GRCm39)	missense	unknown
R7428:Dmbt1	UTSW	7	130,710,192 (GRCm39)	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	130,681,241 (GRCm39)	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	130,668,192 (GRCm39)	missense	unknown
R7513:Dmbt1	UTSW	7	130,692,242 (GRCm39)	missense	unknown
R7553:Dmbt1	UTSW	7	130,706,597 (GRCm39)	missense	unknown
R7567:Dmbt1	UTSW	7	130,663,093 (GRCm39)	splice site	probably null
R7584:Dmbt1	UTSW	7	130,690,481 (GRCm39)	nonsense	probably null
R7736:Dmbt1	UTSW	7	130,718,625 (GRCm39)	missense	unknown
R7758:Dmbt1	UTSW	7	130,722,926 (GRCm39)	missense	unknown
R7928:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	130,690,500 (GRCm39)	missense	unknown
R8098:Dmbt1	UTSW	7	130,710,188 (GRCm39)	nonsense	probably null
R8125:Dmbt1	UTSW	7	130,700,953 (GRCm39)	missense	unknown
R8177:Dmbt1	UTSW	7	130,708,162 (GRCm39)	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	130,668,330 (GRCm39)	missense	unknown
R8378:Dmbt1	UTSW	7	130,708,195 (GRCm39)	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8400:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8445:Dmbt1	UTSW	7	130,692,110 (GRCm39)	missense	unknown
R8450:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	130,703,742 (GRCm39)	missense	unknown
R8688:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	unknown
R8850:Dmbt1	UTSW	7	130,692,134 (GRCm39)	missense	unknown
R8852:Dmbt1	UTSW	7	130,642,853 (GRCm39)	missense	unknown
R8871:Dmbt1	UTSW	7	130,718,597 (GRCm39)	missense	unknown
R8943:Dmbt1	UTSW	7	130,721,372 (GRCm39)	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	130,639,611 (GRCm39)	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	130,713,798 (GRCm39)	missense	unknown
R9020:Dmbt1	UTSW	7	130,712,787 (GRCm39)	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	130,718,418 (GRCm39)	missense	unknown
R9230:Dmbt1	UTSW	7	130,639,642 (GRCm39)	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	130,700,855 (GRCm39)	missense	unknown
R9377:Dmbt1	UTSW	7	130,694,832 (GRCm39)	missense	unknown
R9428:Dmbt1	UTSW	7	130,668,208 (GRCm39)	missense	unknown
R9474:Dmbt1	UTSW	7	130,675,987 (GRCm39)	missense	unknown
R9573:Dmbt1	UTSW	7	130,657,910 (GRCm39)	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	130,712,652 (GRCm39)	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	130,660,015 (GRCm39)	missense	unknown
R9781:Dmbt1	UTSW	7	130,639,599 (GRCm39)	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	130,713,977 (GRCm39)	nonsense	probably null
X0062:Dmbt1	UTSW	7	130,696,581 (GRCm39)	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	130,690,542 (GRCm39)	missense	unknown
Z1177:Dmbt1	UTSW	7	130,684,215 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTAACCTTTTGGCTCCTAGGG -3'
(R):5'- TTGACAGCTGGACAGGTAGG -3'

Sequencing Primer
(F):5'- TGACAAGTAAGACAGCCCTG -3'
(R):5'- TGGACAGGTAGGACTCCCATC -3'

Posted On

2020-08-01