Mutagenetix > Incidental Mutation

Incidental Mutation 'BB005:Adgrb1'

642327

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

B830018M07Rik, Bai1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

BB005

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74388045-74461314 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74410170 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 270 (W270R)

Ref Sequence

ENSEMBL: ENSMUSP00000046097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000042035
AA Change: W270R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: W270R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186360
AA Change: W270R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: W270R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187485
AA Change: W270R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730
AA Change: W270R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Meta Mutation Damage Score

0.5934

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl1	C	T	8: 13,298,682 (GRCm39)	V83I	probably damaging	Het
App	A	T	16: 84,775,134 (GRCm39)	V501D	probably benign	Het
Cnot6l	A	G	5: 96,278,927 (GRCm39)	V97A	possibly damaging	Het
Cntrob	A	G	11: 69,191,121 (GRCm39)	L831P	probably damaging	Het
Dmbt1	T	C	7: 130,639,620 (GRCm39)	S53P	probably benign	Het
Dnah2	T	C	11: 69,321,661 (GRCm39)	D3833G	probably damaging	Het
Dock4	T	C	12: 40,838,302 (GRCm39)	L1081P	probably damaging	Het
Dock7	T	C	4: 98,889,335 (GRCm39)	N185D		Het
Dsn1	T	C	2: 156,847,932 (GRCm39)		probably benign	Het
Evpl	T	C	11: 116,113,359 (GRCm39)	T1444A	possibly damaging	Het
Fanci	T	C	7: 79,094,459 (GRCm39)	L1130P	probably benign	Het
Fancm	A	G	12: 65,152,898 (GRCm39)	D1118G	unknown	Het
G530012D18Rik	C	G	1: 85,504,935 (GRCm39)	D113E	unknown	Het
Gm11596	A	G	11: 99,683,622 (GRCm39)	V166A	unknown	Het
Gm2696	A	T	10: 77,650,723 (GRCm39)	T70S	unknown	Het
Gm5773	A	G	3: 93,680,997 (GRCm39)	E223G	probably damaging	Het
Madd	T	A	2: 91,007,233 (GRCm39)	D293V	probably damaging	Het
Odam	A	G	5: 88,035,269 (GRCm39)	T78A	possibly damaging	Het
Or52ae9	T	A	7: 103,390,397 (GRCm39)	I17F	probably damaging	Het
Rassf3	A	G	10: 121,252,984 (GRCm39)		probably null	Het
Rftn1	G	T	17: 50,354,408 (GRCm39)	A318D	probably damaging	Het
Rhbdf1	T	C	11: 32,159,898 (GRCm39)	Y826C	possibly damaging	Het
Rnf13	C	A	3: 57,671,729 (GRCm39)	Q14K	probably benign	Het
Sec13	A	G	6: 113,706,601 (GRCm39)	S271P	probably damaging	Het
Sema6c	T	C	3: 95,079,620 (GRCm39)	L638P	probably damaging	Het
Sgsh	T	G	11: 119,238,561 (GRCm39)	H301P	probably benign	Het
Shh	T	C	5: 28,666,404 (GRCm39)	M161V	possibly damaging	Het
Stil	C	T	4: 114,887,198 (GRCm39)	H764Y	probably damaging	Het
Vmn1r203	C	T	13: 22,708,705 (GRCm39)	T162I	probably benign	Het
Zfp950	G	T	19: 61,107,938 (GRCm39)	P382T	probably damaging	Het
Zzef1	T	C	11: 72,712,722 (GRCm39)	M214T	probably damaging	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74,458,684 (GRCm39)	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74,420,206 (GRCm39)	splice site	probably benign
IGL01874:Adgrb1	APN	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74,413,424 (GRCm39)	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74,401,631 (GRCm39)	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74,412,326 (GRCm39)	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74,445,961 (GRCm39)	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74,458,654 (GRCm39)	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74,460,143 (GRCm39)	splice site	probably benign
IGL02678:Adgrb1	APN	15	74,410,177 (GRCm39)	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74,419,471 (GRCm39)	missense	probably damaging	0.98
Bunting	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
BB015:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74,413,508 (GRCm39)	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74,444,005 (GRCm39)	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74,458,656 (GRCm39)	missense	probably benign
R0267:Adgrb1	UTSW	15	74,401,238 (GRCm39)	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74,458,998 (GRCm39)	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74,415,198 (GRCm39)	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74,413,408 (GRCm39)	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74,412,741 (GRCm39)	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74,420,398 (GRCm39)	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74,419,534 (GRCm39)	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74,421,888 (GRCm39)	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74,459,956 (GRCm39)	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74,401,192 (GRCm39)	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74,413,676 (GRCm39)	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74,401,389 (GRCm39)	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74,452,435 (GRCm39)	nonsense	probably null
R1895:Adgrb1	UTSW	15	74,412,314 (GRCm39)	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74,411,726 (GRCm39)	splice site	probably benign
R2114:Adgrb1	UTSW	15	74,412,411 (GRCm39)	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74,401,757 (GRCm39)	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74,419,553 (GRCm39)	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74,416,864 (GRCm39)	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74,460,157 (GRCm39)	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74,454,792 (GRCm39)	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74,415,511 (GRCm39)	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74,449,302 (GRCm39)	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74,456,278 (GRCm39)	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74,459,963 (GRCm39)	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74,401,328 (GRCm39)	nonsense	probably null
R4760:Adgrb1	UTSW	15	74,443,312 (GRCm39)	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74,459,978 (GRCm39)	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74,458,871 (GRCm39)	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74,444,011 (GRCm39)	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74,401,664 (GRCm39)	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74,449,348 (GRCm39)	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74,421,876 (GRCm39)	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74,410,219 (GRCm39)	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74,412,308 (GRCm39)	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74,459,992 (GRCm39)	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74,401,210 (GRCm39)	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74,421,873 (GRCm39)	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74,401,750 (GRCm39)	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74,445,959 (GRCm39)	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74,441,730 (GRCm39)	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74,441,797 (GRCm39)	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74,441,733 (GRCm39)	missense	probably benign
R7283:Adgrb1	UTSW	15	74,452,512 (GRCm39)	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74,420,418 (GRCm39)	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74,415,487 (GRCm39)	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74,416,849 (GRCm39)	missense	probably damaging	0.98
R8152:Adgrb1	UTSW	15	74,413,460 (GRCm39)	missense	probably benign	0.00
R8198:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74,420,153 (GRCm39)	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74,447,700 (GRCm39)	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74,415,357 (GRCm39)	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74,415,507 (GRCm39)	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74,441,748 (GRCm39)	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74,415,189 (GRCm39)	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74,420,475 (GRCm39)	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74,435,807 (GRCm39)	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74,419,532 (GRCm39)	missense	probably damaging	0.99
Z1177:Adgrb1	UTSW	15	74,413,525 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCAAAGTTTCCCATGACC -3'
(R):5'- TAGTCAGGGTTAGGCAGGGC -3'

Sequencing Primer
(F):5'- GCAAAGTTTCCCATGACCTTGCC -3'
(R):5'- TTAAGGCATCCCTGTCCCCAAC -3'

Posted On

2020-08-01