Incidental Mutation 'R0043:Usp42'
ID64233
Institutional Source Beutler Lab
Gene Symbol Usp42
Ensembl Gene ENSMUSG00000051306
Gene Nameubiquitin specific peptidase 42
SynonymsA630018G05Rik, D5Ertd591e, 3110031A07Rik, 2410140K03Rik
MMRRC Submission 038337-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0043 (G1)
Quality Score114
Status Not validated
Chromosome5
Chromosomal Location143710325-143732280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 143714710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1186 (V1186G)
Ref Sequence ENSEMBL: ENSMUSP00000053955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053287] [ENSMUST00000116456]
Predicted Effect probably benign
Transcript: ENSMUST00000053287
AA Change: V1186G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306
AA Change: V1186G

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
Pfam:UCH 109 408 1.4e-46 PFAM
Pfam:UCH_1 110 391 1.4e-18 PFAM
low complexity region 470 490 N/A INTRINSIC
low complexity region 567 579 N/A INTRINSIC
low complexity region 604 613 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 954 962 N/A INTRINSIC
low complexity region 1016 1031 N/A INTRINSIC
low complexity region 1201 1219 N/A INTRINSIC
low complexity region 1239 1255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116456
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155408
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit fecundity and behavioral abnormalities, hyperactivity, increased T cell number, abnormal lens morphology, and cataracts. Males display oligozoospermia and testis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Elac1 T C 18: 73,742,453 D169G probably benign Het
Epas1 T C 17: 86,823,812 V340A probably damaging Het
Mki67 T C 7: 135,700,581 D908G probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sycp2 A T 2: 178,364,711 V863D probably damaging Het
Tubb4a T C 17: 57,081,114 D304G probably damaging Het
Other mutations in Usp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Usp42 APN 5 143717142 missense probably benign 0.00
IGL00902:Usp42 APN 5 143719874 splice site probably benign
IGL01326:Usp42 APN 5 143721215 missense possibly damaging 0.54
IGL01985:Usp42 APN 5 143715185 missense probably damaging 1.00
IGL02629:Usp42 APN 5 143723154 missense possibly damaging 0.94
IGL02683:Usp42 APN 5 143715346 missense possibly damaging 0.55
IGL02700:Usp42 APN 5 143717128 missense probably benign 0.01
IGL02965:Usp42 APN 5 143728014 missense probably damaging 1.00
PIT4468001:Usp42 UTSW 5 143714644 missense probably damaging 1.00
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0420:Usp42 UTSW 5 143714861 missense probably damaging 0.99
R1066:Usp42 UTSW 5 143718041 missense probably damaging 1.00
R1345:Usp42 UTSW 5 143717333 missense probably damaging 1.00
R1628:Usp42 UTSW 5 143717367 missense probably damaging 1.00
R1728:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1729:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1767:Usp42 UTSW 5 143714866 missense possibly damaging 0.69
R1772:Usp42 UTSW 5 143717102 missense probably damaging 1.00
R1784:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1916:Usp42 UTSW 5 143715056 missense probably damaging 1.00
R2425:Usp42 UTSW 5 143715839 missense probably benign 0.09
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2886:Usp42 UTSW 5 143721629 splice site probably benign
R3195:Usp42 UTSW 5 143717199 missense probably benign 0.02
R3737:Usp42 UTSW 5 143715439 missense probably benign 0.00
R3738:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4034:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4795:Usp42 UTSW 5 143723937 missense probably damaging 1.00
R4940:Usp42 UTSW 5 143719762 missense probably damaging 1.00
R4967:Usp42 UTSW 5 143715364 missense possibly damaging 0.71
R5282:Usp42 UTSW 5 143721646 missense probably damaging 1.00
R5773:Usp42 UTSW 5 143713712 missense probably benign 0.03
R5778:Usp42 UTSW 5 143719576 missense probably damaging 1.00
R5933:Usp42 UTSW 5 143715515 missense probably benign 0.00
R6192:Usp42 UTSW 5 143717187 missense possibly damaging 0.73
R6275:Usp42 UTSW 5 143714972 missense probably damaging 1.00
R6496:Usp42 UTSW 5 143715103 missense probably damaging 1.00
R6825:Usp42 UTSW 5 143727807 missense probably damaging 1.00
R6939:Usp42 UTSW 5 143727969 missense probably damaging 1.00
R7099:Usp42 UTSW 5 143726645 missense probably damaging 1.00
R7356:Usp42 UTSW 5 143717087 missense possibly damaging 0.56
R7876:Usp42 UTSW 5 143721671 missense probably damaging 1.00
R7959:Usp42 UTSW 5 143721671 missense probably damaging 1.00
X0022:Usp42 UTSW 5 143716060 frame shift probably null
X0027:Usp42 UTSW 5 143717078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTCACTCTAAGCAGGCAAACAGG -3'
(R):5'- TCGAGAGACATCTCCAAGAGAAGGC -3'

Sequencing Primer
(F):5'- CCAACAACTTCAAAGCTGTGTG -3'
(R):5'- CAAGAGAAGGCTGCGCTG -3'
Posted On2013-08-06