Incidental Mutation 'BB006:Nceh1'
ID642342
Institutional Source Beutler Lab
Gene Symbol Nceh1
Ensembl Gene ENSMUSG00000027698
Gene Nameneutral cholesterol ester hydrolase 1
SynonymsAadacl1, mKIAA1363, B230106I24Rik, CPO-BP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #BB006
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location27182965-27284608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27279247 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000088829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091284]
Predicted Effect probably benign
Transcript: ENSMUST00000091284
AA Change: D164G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088829
Gene: ENSMUSG00000027698
AA Change: D164G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Abhydrolase_3 109 152 6.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal organophosphorus metabolism and cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,978,520 I105F possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Adra1d G T 2: 131,561,680 C163* probably null Het
AI314180 A G 4: 58,869,554 C238R probably damaging Het
Ak9 A G 10: 41,383,948 D874G Het
Akap8 A T 17: 32,309,445 S498T probably damaging Het
Alyref2 C G 1: 171,503,839 F61L probably benign Het
Ank1 A T 8: 23,116,107 I1172F probably damaging Het
Ankrd50 A T 3: 38,457,109 F370I probably damaging Het
Apip A C 2: 103,083,021 T41P probably benign Het
Atg4d G A 9: 21,266,964 R126Q probably null Het
Ccdc129 G A 6: 55,897,961 V299M probably damaging Het
Ccdc86 A G 19: 10,948,819 S139P unknown Het
Ceacam16 A G 7: 19,853,631 L404P probably damaging Het
Dennd3 G T 15: 73,564,574 V1010L probably damaging Het
Disp1 A G 1: 183,135,539 S108P probably benign Het
Ephb2 A G 4: 136,660,884 V635A probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gars A G 6: 55,063,117 H343R probably damaging Het
Gli2 A T 1: 118,842,042 N593K possibly damaging Het
Il18rap T A 1: 40,531,580 N227K probably damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Jak1 A T 4: 101,154,645 F1087I probably damaging Het
Klf16 A G 10: 80,576,864 S113P probably benign Het
Klhl30 A T 1: 91,355,516 E280V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lama4 A G 10: 39,078,847 H1132R probably damaging Het
Lmtk3 A G 7: 45,795,148 D1085G unknown Het
Lrrc9 C A 12: 72,486,297 T980K possibly damaging Het
Nlrp2 A G 7: 5,327,499 S633P probably damaging Het
Nxn A G 11: 76,274,037 V216A possibly damaging Het
Odf4 A T 11: 68,922,933 V143D possibly damaging Het
Olfr1428 G A 19: 12,108,754 T38I unknown Het
Pex12 A G 11: 83,297,983 I62T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plekhg1 G A 10: 3,919,170 D237N probably damaging Het
Rxrb T A 17: 34,036,671 D377E probably benign Het
Ryr2 T A 13: 11,594,794 D4382V probably damaging Het
Ryr2 T A 13: 11,690,295 K2862* probably null Het
Ryr3 A G 2: 112,834,188 L1606P probably benign Het
Samd3 A G 10: 26,251,915 K270R probably damaging Het
Slc2a5 C A 4: 150,139,485 F211L probably benign Het
Spata31 T A 13: 64,921,718 V560D probably benign Het
Tbk1 A G 10: 121,557,233 C471R probably benign Het
Tbx20 A T 9: 24,725,763 S343T possibly damaging Het
Tesk2 A G 4: 116,802,255 E304G probably benign Het
Tle1 A G 4: 72,200,002 F2L possibly damaging Het
Tle4 G T 19: 14,517,880 P162T probably benign Het
Ttn G A 2: 76,843,472 P11172S unknown Het
Tulp1 T C 17: 28,353,772 N470S possibly damaging Het
Unc13b A G 4: 43,174,399 I1742M unknown Het
Vmn2r107 T G 17: 20,345,444 I7S probably null Het
Vmn2r91 T G 17: 18,107,644 I500R probably damaging Het
Xpnpep3 A G 15: 81,427,425 I111V probably damaging Het
Zp3r T A 1: 130,591,480 E308V probably benign Het
Other mutations in Nceh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Nceh1 APN 3 27241313 missense probably damaging 1.00
IGL02113:Nceh1 APN 3 27222891 missense probably damaging 1.00
cerdo UTSW 3 27241271 nonsense probably null
BB016:Nceh1 UTSW 3 27279247 missense probably benign 0.00
R0281:Nceh1 UTSW 3 27222804 missense possibly damaging 0.64
R0854:Nceh1 UTSW 3 27241319 missense probably damaging 1.00
R1562:Nceh1 UTSW 3 27239552 missense probably damaging 1.00
R1689:Nceh1 UTSW 3 27226082 missense probably damaging 0.99
R1918:Nceh1 UTSW 3 27183175 missense probably damaging 1.00
R2851:Nceh1 UTSW 3 27241355 missense probably damaging 1.00
R3959:Nceh1 UTSW 3 27279196 missense probably benign 0.01
R4420:Nceh1 UTSW 3 27241649 missense probably damaging 1.00
R4686:Nceh1 UTSW 3 27241669 missense probably damaging 1.00
R5165:Nceh1 UTSW 3 27241528 missense probably benign
R5243:Nceh1 UTSW 3 27241688 missense probably damaging 1.00
R5255:Nceh1 UTSW 3 27183139 missense probably damaging 0.96
R5598:Nceh1 UTSW 3 27226099 missense probably benign 0.01
R6076:Nceh1 UTSW 3 27279195 missense probably benign 0.00
R6337:Nceh1 UTSW 3 27222807 missense probably damaging 0.96
R6729:Nceh1 UTSW 3 27241271 nonsense probably null
R6744:Nceh1 UTSW 3 27241789 missense probably damaging 1.00
R7618:Nceh1 UTSW 3 27183217 critical splice donor site probably null
R7749:Nceh1 UTSW 3 27207382 missense probably benign
R7929:Nceh1 UTSW 3 27279247 missense probably benign 0.00
R8040:Nceh1 UTSW 3 27241225 missense probably benign 0.00
R8350:Nceh1 UTSW 3 27239664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCCACCGTGAAGCATTGG -3'
(R):5'- TGAGAGCCAGCTACTGACTGTG -3'

Sequencing Primer
(F):5'- TGGCTTTGCAACACTGTGAGAAAC -3'
(R):5'- ACTGACTGTGGCACCTTG -3'
Posted On2020-08-01