Incidental Mutation 'R0043:Tubb4a'
ID64235
Institutional Source Beutler Lab
Gene Symbol Tubb4a
Ensembl Gene ENSMUSG00000062591
Gene Nametubulin, beta 4A class IVA
SynonymsTubb, Tubb4
MMRRC Submission 038337-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0043 (G1)
Quality Score144
Status Not validated
Chromosome17
Chromosomal Location57080066-57087782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57081114 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 304 (D304G)
Ref Sequence ENSEMBL: ENSMUSP00000071135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071135]
Predicted Effect probably benign
Transcript: ENSMUST00000011623
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071135
AA Change: D304G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071135
Gene: ENSMUSG00000062591
AA Change: D304G

DomainStartEndE-ValueType
Tubulin 47 244 4.45e-67 SMART
Tubulin_C 246 383 5.5e-49 SMART
low complexity region 428 444 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. Mutations in this gene cause hypomyelinating leukodystrophy-6 and autosomal dominant torsion dystonia-4. Alternate splicing results in multiple transcript variants encoding different isoforms. A pseudogene of this gene is found on chromosome X. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Elac1 T C 18: 73,742,453 D169G probably benign Het
Epas1 T C 17: 86,823,812 V340A probably damaging Het
Mki67 T C 7: 135,700,581 D908G probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sycp2 A T 2: 178,364,711 V863D probably damaging Het
Usp42 A C 5: 143,714,710 V1186G probably benign Het
Other mutations in Tubb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Tubb4a APN 17 57086072 missense probably benign 0.24
IGL02343:Tubb4a APN 17 57081538 missense probably benign
IGL02562:Tubb4a APN 17 57081163 nonsense probably null
P0022:Tubb4a UTSW 17 57081538 missense probably benign
R0195:Tubb4a UTSW 17 57081499 missense probably damaging 1.00
R0309:Tubb4a UTSW 17 57081182 nonsense probably null
R0348:Tubb4a UTSW 17 57080770 missense probably damaging 0.98
R2440:Tubb4a UTSW 17 57086285 missense probably damaging 1.00
R2762:Tubb4a UTSW 17 57080974 missense probably benign
R3927:Tubb4a UTSW 17 57080967 missense probably benign 0.00
R6284:Tubb4a UTSW 17 57080833 missense probably damaging 1.00
R6351:Tubb4a UTSW 17 57081016 missense probably damaging 1.00
R6760:Tubb4a UTSW 17 57080796 missense possibly damaging 0.82
R6822:Tubb4a UTSW 17 57080904 missense probably damaging 0.99
R7381:Tubb4a UTSW 17 57080698 missense unknown
R7507:Tubb4a UTSW 17 57081642 missense probably damaging 1.00
R7892:Tubb4a UTSW 17 57080880 nonsense probably null
R7975:Tubb4a UTSW 17 57080880 nonsense probably null
RF013:Tubb4a UTSW 17 57087464 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGAACAGCTCCTGGATGGCAGTG -3'
(R):5'- CCAGCTCAATGCAGATCTACGCAAG -3'

Sequencing Primer
(F):5'- AGTGCTGTTGCCGATGAAG -3'
(R):5'- GCTGGCTGTGAATATGGTGC -3'
Posted On2013-08-06