Incidental Mutation 'BB006:Tesk2'
ID642350
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Nametestis-specific kinase 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #BB006
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location116720948-116805956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116802255 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 304 (E304G)
Ref Sequence ENSEMBL: ENSMUSP00000041009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
AA Change: E304G

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: E304G

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106456
AA Change: E275G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985
AA Change: E275G

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145468
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Meta Mutation Damage Score 0.3128 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,978,520 I105F possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Adra1d G T 2: 131,561,680 C163* probably null Het
AI314180 A G 4: 58,869,554 C238R probably damaging Het
Ak9 A G 10: 41,383,948 D874G Het
Akap8 A T 17: 32,309,445 S498T probably damaging Het
Alyref2 C G 1: 171,503,839 F61L probably benign Het
Ank1 A T 8: 23,116,107 I1172F probably damaging Het
Ankrd50 A T 3: 38,457,109 F370I probably damaging Het
Apip A C 2: 103,083,021 T41P probably benign Het
Atg4d G A 9: 21,266,964 R126Q probably null Het
Ccdc129 G A 6: 55,897,961 V299M probably damaging Het
Ccdc86 A G 19: 10,948,819 S139P unknown Het
Ceacam16 A G 7: 19,853,631 L404P probably damaging Het
Dennd3 G T 15: 73,564,574 V1010L probably damaging Het
Disp1 A G 1: 183,135,539 S108P probably benign Het
Ephb2 A G 4: 136,660,884 V635A probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gars A G 6: 55,063,117 H343R probably damaging Het
Gli2 A T 1: 118,842,042 N593K possibly damaging Het
Il18rap T A 1: 40,531,580 N227K probably damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Jak1 A T 4: 101,154,645 F1087I probably damaging Het
Klf16 A G 10: 80,576,864 S113P probably benign Het
Klhl30 A T 1: 91,355,516 E280V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lama4 A G 10: 39,078,847 H1132R probably damaging Het
Lmtk3 A G 7: 45,795,148 D1085G unknown Het
Lrrc9 C A 12: 72,486,297 T980K possibly damaging Het
Nceh1 A G 3: 27,279,247 D164G probably benign Het
Nlrp2 A G 7: 5,327,499 S633P probably damaging Het
Nxn A G 11: 76,274,037 V216A possibly damaging Het
Odf4 A T 11: 68,922,933 V143D possibly damaging Het
Olfr1428 G A 19: 12,108,754 T38I unknown Het
Pex12 A G 11: 83,297,983 I62T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plekhg1 G A 10: 3,919,170 D237N probably damaging Het
Rxrb T A 17: 34,036,671 D377E probably benign Het
Ryr2 T A 13: 11,594,794 D4382V probably damaging Het
Ryr2 T A 13: 11,690,295 K2862* probably null Het
Ryr3 A G 2: 112,834,188 L1606P probably benign Het
Samd3 A G 10: 26,251,915 K270R probably damaging Het
Slc2a5 C A 4: 150,139,485 F211L probably benign Het
Spata31 T A 13: 64,921,718 V560D probably benign Het
Tbk1 A G 10: 121,557,233 C471R probably benign Het
Tbx20 A T 9: 24,725,763 S343T possibly damaging Het
Tle1 A G 4: 72,200,002 F2L possibly damaging Het
Tle4 G T 19: 14,517,880 P162T probably benign Het
Ttn G A 2: 76,843,472 P11172S unknown Het
Tulp1 T C 17: 28,353,772 N470S possibly damaging Het
Unc13b A G 4: 43,174,399 I1742M unknown Het
Vmn2r107 T G 17: 20,345,444 I7S probably null Het
Vmn2r91 T G 17: 18,107,644 I500R probably damaging Het
Xpnpep3 A G 15: 81,427,425 I111V probably damaging Het
Zp3r T A 1: 130,591,480 E308V probably benign Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
BB016:Tesk2 UTSW 4 116802255 missense probably benign 0.08
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R2414:Tesk2 UTSW 4 116801757 missense possibly damaging 0.96
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5278:Tesk2 UTSW 4 116805936 intron probably benign
R5769:Tesk2 UTSW 4 116802315 splice site probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6464:Tesk2 UTSW 4 116802849 missense probably damaging 1.00
R6567:Tesk2 UTSW 4 116792164 missense probably damaging 1.00
R6867:Tesk2 UTSW 4 116801798 missense probably damaging 0.99
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
R7929:Tesk2 UTSW 4 116802255 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTCCTTGAGTGCTGACCAAG -3'
(R):5'- TTACTGCCCATGACCACTG -3'

Sequencing Primer
(F):5'- ACCAAGCTTTGTCAGGTTTTATTTG -3'
(R):5'- CCCATGACCACTGCCCTC -3'
Posted On2020-08-01