Incidental Mutation 'BB006:Nlrp2'
ID 642355
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB006
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5330498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 633 (S633P)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: S633P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: S633P

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 37,289,412 (GRCm39) I105F possibly damaging Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
Adra1d G T 2: 131,403,600 (GRCm39) C163* probably null Het
Ak9 A G 10: 41,259,944 (GRCm39) D874G Het
Akap8 A T 17: 32,528,419 (GRCm39) S498T probably damaging Het
Alyref2 C G 1: 171,331,407 (GRCm39) F61L probably benign Het
Ank1 A T 8: 23,606,123 (GRCm39) I1172F probably damaging Het
Ankrd50 A T 3: 38,511,258 (GRCm39) F370I probably damaging Het
Apip A C 2: 102,913,366 (GRCm39) T41P probably benign Het
Atg4d G A 9: 21,178,260 (GRCm39) R126Q probably null Het
Ccdc86 A G 19: 10,926,183 (GRCm39) S139P unknown Het
Ceacam16 A G 7: 19,587,556 (GRCm39) L404P probably damaging Het
Dennd3 G T 15: 73,436,423 (GRCm39) V1010L probably damaging Het
Disp1 A G 1: 182,917,103 (GRCm39) S108P probably benign Het
Ecpas A G 4: 58,869,554 (GRCm39) C238R probably damaging Het
Ephb2 A G 4: 136,388,195 (GRCm39) V635A probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gars1 A G 6: 55,040,102 (GRCm39) H343R probably damaging Het
Gli2 A T 1: 118,769,772 (GRCm39) N593K possibly damaging Het
Il18rap T A 1: 40,570,740 (GRCm39) N227K probably damaging Het
Il4ra T C 7: 125,174,348 (GRCm39) S297P probably benign Het
Itprid1 G A 6: 55,874,946 (GRCm39) V299M probably damaging Het
Jak1 A T 4: 101,011,842 (GRCm39) F1087I probably damaging Het
Klf16 A G 10: 80,412,698 (GRCm39) S113P probably benign Het
Klhl30 A T 1: 91,283,238 (GRCm39) E280V possibly damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lama4 A G 10: 38,954,843 (GRCm39) H1132R probably damaging Het
Lmtk3 A G 7: 45,444,572 (GRCm39) D1085G unknown Het
Lrrc9 C A 12: 72,533,071 (GRCm39) T980K possibly damaging Het
Nceh1 A G 3: 27,333,396 (GRCm39) D164G probably benign Het
Nxn A G 11: 76,164,863 (GRCm39) V216A possibly damaging Het
Odf4 A T 11: 68,813,759 (GRCm39) V143D possibly damaging Het
Or4d6 G A 19: 12,086,118 (GRCm39) T38I unknown Het
Pex12 A G 11: 83,188,809 (GRCm39) I62T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plekhg1 G A 10: 3,869,170 (GRCm39) D237N probably damaging Het
Rxrb T A 17: 34,255,645 (GRCm39) D377E probably benign Het
Ryr2 T A 13: 11,609,680 (GRCm39) D4382V probably damaging Het
Ryr2 T A 13: 11,705,181 (GRCm39) K2862* probably null Het
Ryr3 A G 2: 112,664,533 (GRCm39) L1606P probably benign Het
Samd3 A G 10: 26,127,813 (GRCm39) K270R probably damaging Het
Slc2a5 C A 4: 150,223,942 (GRCm39) F211L probably benign Het
Spata31 T A 13: 65,069,532 (GRCm39) V560D probably benign Het
Tbk1 A G 10: 121,393,138 (GRCm39) C471R probably benign Het
Tbx20 A T 9: 24,637,059 (GRCm39) S343T possibly damaging Het
Tesk2 A G 4: 116,659,452 (GRCm39) E304G probably benign Het
Tle1 A G 4: 72,118,239 (GRCm39) F2L possibly damaging Het
Tle4 G T 19: 14,495,244 (GRCm39) P162T probably benign Het
Ttn G A 2: 76,673,816 (GRCm39) P11172S unknown Het
Tulp1 T C 17: 28,572,746 (GRCm39) N470S possibly damaging Het
Unc13b A G 4: 43,174,399 (GRCm39) I1742M unknown Het
Vmn2r107 T G 17: 20,565,706 (GRCm39) I7S probably null Het
Vmn2r91 T G 17: 18,327,906 (GRCm39) I500R probably damaging Het
Xpnpep3 A G 15: 81,311,626 (GRCm39) I111V probably damaging Het
Zp3r T A 1: 130,519,217 (GRCm39) E308V probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5,311,769 (GRCm39) missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5,330,614 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6173:Nlrp2 UTSW 7 5,340,808 (GRCm39) missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5,330,627 (GRCm39) missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5,330,548 (GRCm39) missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCAACCTTGACCTATAGAGAATGAG -3'
(R):5'- AATTCCTGGAGTGTGAGTCAGG -3'

Sequencing Primer
(F):5'- CCTATAGAGAATGAGAGACTTCAGCC -3'
(R):5'- TGTGAGTCAGGGGAAAATAAACCC -3'
Posted On 2020-08-01