Incidental Mutation 'BB006:Nlrp2'
ID642355
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB006
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5327499 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 633 (S633P)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: S633P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: S633P

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,978,520 I105F possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Adra1d G T 2: 131,561,680 C163* probably null Het
AI314180 A G 4: 58,869,554 C238R probably damaging Het
Ak9 A G 10: 41,383,948 D874G Het
Akap8 A T 17: 32,309,445 S498T probably damaging Het
Alyref2 C G 1: 171,503,839 F61L probably benign Het
Ank1 A T 8: 23,116,107 I1172F probably damaging Het
Ankrd50 A T 3: 38,457,109 F370I probably damaging Het
Apip A C 2: 103,083,021 T41P probably benign Het
Atg4d G A 9: 21,266,964 R126Q probably null Het
Ccdc129 G A 6: 55,897,961 V299M probably damaging Het
Ccdc86 A G 19: 10,948,819 S139P unknown Het
Ceacam16 A G 7: 19,853,631 L404P probably damaging Het
Dennd3 G T 15: 73,564,574 V1010L probably damaging Het
Disp1 A G 1: 183,135,539 S108P probably benign Het
Ephb2 A G 4: 136,660,884 V635A probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gars A G 6: 55,063,117 H343R probably damaging Het
Gli2 A T 1: 118,842,042 N593K possibly damaging Het
Il18rap T A 1: 40,531,580 N227K probably damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Jak1 A T 4: 101,154,645 F1087I probably damaging Het
Klf16 A G 10: 80,576,864 S113P probably benign Het
Klhl30 A T 1: 91,355,516 E280V possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lama4 A G 10: 39,078,847 H1132R probably damaging Het
Lmtk3 A G 7: 45,795,148 D1085G unknown Het
Lrrc9 C A 12: 72,486,297 T980K possibly damaging Het
Nceh1 A G 3: 27,279,247 D164G probably benign Het
Nxn A G 11: 76,274,037 V216A possibly damaging Het
Odf4 A T 11: 68,922,933 V143D possibly damaging Het
Olfr1428 G A 19: 12,108,754 T38I unknown Het
Pex12 A G 11: 83,297,983 I62T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plekhg1 G A 10: 3,919,170 D237N probably damaging Het
Rxrb T A 17: 34,036,671 D377E probably benign Het
Ryr2 T A 13: 11,690,295 K2862* probably null Het
Ryr2 T A 13: 11,594,794 D4382V probably damaging Het
Ryr3 A G 2: 112,834,188 L1606P probably benign Het
Samd3 A G 10: 26,251,915 K270R probably damaging Het
Slc2a5 C A 4: 150,139,485 F211L probably benign Het
Spata31 T A 13: 64,921,718 V560D probably benign Het
Tbk1 A G 10: 121,557,233 C471R probably benign Het
Tbx20 A T 9: 24,725,763 S343T possibly damaging Het
Tesk2 A G 4: 116,802,255 E304G probably benign Het
Tle1 A G 4: 72,200,002 F2L possibly damaging Het
Tle4 G T 19: 14,517,880 P162T probably benign Het
Ttn G A 2: 76,843,472 P11172S unknown Het
Tulp1 T C 17: 28,353,772 N470S possibly damaging Het
Unc13b A G 4: 43,174,399 I1742M unknown Het
Vmn2r107 T G 17: 20,345,444 I7S probably null Het
Vmn2r91 T G 17: 18,107,644 I500R probably damaging Het
Xpnpep3 A G 15: 81,427,425 I111V probably damaging Het
Zp3r T A 1: 130,591,480 E308V probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCAACCTTGACCTATAGAGAATGAG -3'
(R):5'- AATTCCTGGAGTGTGAGTCAGG -3'

Sequencing Primer
(F):5'- CCTATAGAGAATGAGAGACTTCAGCC -3'
(R):5'- TGTGAGTCAGGGGAAAATAAACCC -3'
Posted On2020-08-01