Incidental Mutation 'R0043:Epas1'
ID 64236
Institutional Source Beutler Lab
Gene Symbol Epas1
Ensembl Gene ENSMUSG00000024140
Gene Name endothelial PAS domain protein 1
Synonyms hypoxia inducible transcription factor 2alpha, MOP2, Hif like protein, HIF2A, HLF, HIF-2alpha, bHLHe73, HRF
MMRRC Submission 038337-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0043 (G1)
Quality Score 143
Status Not validated
Chromosome 17
Chromosomal Location 87061292-87140838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87131240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 340 (V340A)
Ref Sequence ENSEMBL: ENSMUSP00000024954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024954]
AlphaFold P97481
Predicted Effect probably damaging
Transcript: ENSMUST00000024954
AA Change: V340A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: V340A

DomainStartEndE-ValueType
HLH 20 75 3.98e-9 SMART
PAS 86 152 6.39e-9 SMART
PAS 232 298 6.75e-8 SMART
PAC 304 347 5.56e-9 SMART
low complexity region 464 484 N/A INTRINSIC
Pfam:HIF-1 516 548 4.9e-21 PFAM
low complexity region 725 737 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
Pfam:HIF-1a_CTAD 837 873 3.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Elac1 T C 18: 73,875,524 (GRCm39) D169G probably benign Het
Mki67 T C 7: 135,302,310 (GRCm39) D908G probably benign Het
Spink12 T C 18: 44,240,763 (GRCm39) C50R probably damaging Het
Sycp2 A T 2: 178,006,504 (GRCm39) V863D probably damaging Het
Tubb4a T C 17: 57,388,114 (GRCm39) D304G probably damaging Het
Usp42 A C 5: 143,700,465 (GRCm39) V1186G probably benign Het
Other mutations in Epas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Epas1 APN 17 87,131,157 (GRCm39) missense probably damaging 1.00
IGL02150:Epas1 APN 17 87,112,717 (GRCm39) missense probably damaging 1.00
IGL02221:Epas1 APN 17 87,135,275 (GRCm39) missense possibly damaging 0.50
IGL02555:Epas1 APN 17 87,136,492 (GRCm39) missense probably benign
IGL02739:Epas1 APN 17 87,112,710 (GRCm39) missense probably damaging 0.98
IGL03389:Epas1 APN 17 87,131,131 (GRCm39) missense probably benign 0.10
R0363:Epas1 UTSW 17 87,113,276 (GRCm39) splice site probably benign
R0399:Epas1 UTSW 17 87,112,621 (GRCm39) missense probably benign 0.01
R0737:Epas1 UTSW 17 87,136,884 (GRCm39) missense possibly damaging 0.45
R1542:Epas1 UTSW 17 87,131,918 (GRCm39) missense possibly damaging 0.67
R1662:Epas1 UTSW 17 87,136,455 (GRCm39) missense probably damaging 0.99
R1885:Epas1 UTSW 17 87,112,723 (GRCm39) missense probably damaging 1.00
R2197:Epas1 UTSW 17 87,136,471 (GRCm39) missense probably benign 0.01
R3056:Epas1 UTSW 17 87,138,409 (GRCm39) missense probably damaging 0.99
R4342:Epas1 UTSW 17 87,131,228 (GRCm39) missense probably damaging 1.00
R4391:Epas1 UTSW 17 87,117,091 (GRCm39) missense probably benign 0.00
R4774:Epas1 UTSW 17 87,113,186 (GRCm39) missense probably damaging 1.00
R4798:Epas1 UTSW 17 87,113,267 (GRCm39) missense probably benign
R4989:Epas1 UTSW 17 87,116,882 (GRCm39) missense probably damaging 1.00
R5133:Epas1 UTSW 17 87,116,882 (GRCm39) missense probably damaging 1.00
R5604:Epas1 UTSW 17 87,113,200 (GRCm39) missense probably damaging 1.00
R5811:Epas1 UTSW 17 87,131,203 (GRCm39) missense probably damaging 1.00
R5838:Epas1 UTSW 17 87,131,114 (GRCm39) missense possibly damaging 0.94
R5885:Epas1 UTSW 17 87,134,972 (GRCm39) missense probably damaging 1.00
R5932:Epas1 UTSW 17 87,135,074 (GRCm39) missense possibly damaging 0.66
R6045:Epas1 UTSW 17 87,116,827 (GRCm39) missense probably damaging 0.99
R6145:Epas1 UTSW 17 87,136,857 (GRCm39) missense probably benign 0.01
R7517:Epas1 UTSW 17 87,138,526 (GRCm39) missense possibly damaging 0.92
R7552:Epas1 UTSW 17 87,136,471 (GRCm39) missense probably benign 0.01
R7828:Epas1 UTSW 17 87,135,127 (GRCm39) missense probably benign 0.04
R8081:Epas1 UTSW 17 87,136,797 (GRCm39) missense probably benign
R8111:Epas1 UTSW 17 87,125,860 (GRCm39) nonsense probably null
R8558:Epas1 UTSW 17 87,116,896 (GRCm39) missense possibly damaging 0.89
R8948:Epas1 UTSW 17 87,134,920 (GRCm39) missense probably benign 0.01
R9074:Epas1 UTSW 17 87,135,267 (GRCm39) missense probably benign 0.41
R9204:Epas1 UTSW 17 87,116,873 (GRCm39) missense probably damaging 1.00
R9228:Epas1 UTSW 17 87,133,990 (GRCm39) missense possibly damaging 0.71
R9319:Epas1 UTSW 17 87,104,545 (GRCm39) missense possibly damaging 0.88
R9562:Epas1 UTSW 17 87,112,667 (GRCm39) missense probably damaging 1.00
R9565:Epas1 UTSW 17 87,112,667 (GRCm39) missense probably damaging 1.00
R9607:Epas1 UTSW 17 87,134,038 (GRCm39) missense probably benign 0.04
Z1176:Epas1 UTSW 17 87,135,374 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAGGCAAACATCTGCTTTCCTTC -3'
(R):5'- TGGCAGCCGCTCATAGTCTTTC -3'

Sequencing Primer
(F):5'- AGAGTTGGCTGAAATGATCTCCC -3'
(R):5'- TTACCCAGGAGAGCACTGTC -3'
Posted On 2013-08-06