Incidental Mutation 'R0043:Elac1'
ID64238
Institutional Source Beutler Lab
Gene Symbol Elac1
Ensembl Gene ENSMUSG00000036941
Gene NameelaC ribonuclease Z 1
Synonyms
MMRRC Submission 038337-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0043 (G1)
Quality Score106
Status Not validated
Chromosome18
Chromosomal Location73735038-73754479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73742453 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000041793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041138]
Predicted Effect probably benign
Transcript: ENSMUST00000041138
AA Change: D169G

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041793
Gene: ENSMUSG00000036941
AA Change: D169G

DomainStartEndE-ValueType
Lactamase_B 20 181 9.65e-1 SMART
low complexity region 255 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transposon insertion are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Epas1 T C 17: 86,823,812 V340A probably damaging Het
Mki67 T C 7: 135,700,581 D908G probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sycp2 A T 2: 178,364,711 V863D probably damaging Het
Tubb4a T C 17: 57,081,114 D304G probably damaging Het
Usp42 A C 5: 143,714,710 V1186G probably benign Het
Other mutations in Elac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Elac1 APN 18 73738920 missense probably benign 0.01
IGL02527:Elac1 APN 18 73747233 nonsense probably null
IGL03036:Elac1 APN 18 73738914 missense probably benign 0.03
R0243:Elac1 UTSW 18 73742363 missense probably damaging 1.00
R0615:Elac1 UTSW 18 73738883 missense probably damaging 1.00
R0737:Elac1 UTSW 18 73739039 missense probably damaging 1.00
R1872:Elac1 UTSW 18 73742646 missense probably benign 0.05
R1900:Elac1 UTSW 18 73739245 missense probably damaging 1.00
R2295:Elac1 UTSW 18 73739229 missense probably benign
R5266:Elac1 UTSW 18 73742669 missense probably benign 0.00
R5432:Elac1 UTSW 18 73742793 missense possibly damaging 0.67
R6301:Elac1 UTSW 18 73738868 missense probably damaging 1.00
R7238:Elac1 UTSW 18 73739288 missense probably damaging 1.00
R7672:Elac1 UTSW 18 73738854 missense probably benign
Z1088:Elac1 UTSW 18 73739090 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTTTGGGCCAAGCAAGTGAGTG -3'
(R):5'- GGCTTCGGGACTTTATCTGGAGAAC -3'

Sequencing Primer
(F):5'- AAGCAAGTGAGTGCTTCCTC -3'
(R):5'- AGCTCTCTCACACGGAGTTG -3'
Posted On2013-08-06