Incidental Mutation 'BB007:Adam23'
ID642389
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB007
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63585427 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 805 (V805F)
Ref Sequence ENSEMBL: ENSMUSP00000084633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087374
AA Change: V805F

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: V805F

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114103
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114107
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,675,756 C609* probably null Het
Adam20 C T 8: 40,797,070 T739I probably benign Het
Adamts17 A T 7: 66,849,799 R31S probably damaging Het
Ano4 T A 10: 89,327,276 Y27F possibly damaging Het
Bbs2 A G 8: 94,069,997 V675A probably damaging Het
Brca2 A G 5: 150,558,510 E2839G probably damaging Het
Capn5 C T 7: 98,123,878 V640I probably benign Het
Casp4 C T 9: 5,321,318 T23M probably damaging Het
Cerk C T 15: 86,144,719 E379K possibly damaging Het
Comp G A 8: 70,373,853 G26D probably damaging Het
Cpxm1 G A 2: 130,395,062 A220V possibly damaging Het
Cyp2c69 G T 19: 39,842,990 P460T possibly damaging Het
Ddx23 T C 15: 98,648,623 D555G probably damaging Het
E2f6 T A 12: 16,819,057 I127K probably damaging Het
Efr3a T A 15: 65,861,740 D716E probably benign Het
Esp16 T G 17: 39,539,977 S82R possibly damaging Het
Fasn A C 11: 120,809,235 S2199A probably benign Het
Fscb A G 12: 64,472,563 S710P unknown Het
Gas7 A G 11: 67,665,391 I185M probably damaging Het
Glg1 A T 8: 111,160,735 L1047I possibly damaging Het
Golga5 A G 12: 102,484,422 N445D probably benign Het
Grin2c A T 11: 115,256,237 H377Q probably benign Het
Hmgcs1 T C 13: 119,699,963 I97T possibly damaging Het
Ifi211 T C 1: 173,906,203 T131A possibly damaging Het
Ifngr1 A G 10: 19,609,183 K310R probably damaging Het
Il18rap T C 1: 40,548,643 V467A probably damaging Het
Itgad C A 7: 128,183,108 Q239K probably benign Het
Jrkl T C 9: 13,245,501 I52V possibly damaging Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Krt75 C A 15: 101,564,883 *552L probably null Het
Mbd2 A G 18: 70,568,877 D154G probably damaging Het
Mutyh A T 4: 116,816,956 N235Y probably benign Het
Myo5b A G 18: 74,731,754 T1348A probably benign Het
Ndufs7 T C 10: 80,253,785 probably null Het
Nup205 T G 6: 35,194,576 M458R probably damaging Het
Olfr1061 T A 2: 86,413,216 T279S probably damaging Het
Olfr1416 T A 1: 92,479,848 M258L probably benign Het
Olfr1475 G A 19: 13,479,655 P181L probably damaging Het
Olfr350 G T 2: 36,850,273 V76F probably damaging Het
Olfr392 A C 11: 73,815,100 probably benign Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr888 A G 9: 38,108,968 N89S possibly damaging Het
Plcl2 T G 17: 50,606,803 I280S probably benign Het
Ppargc1a A T 5: 51,472,922 Y618N unknown Het
Rab43 A T 6: 87,811,366 I60N probably damaging Het
Rnf126 A T 10: 79,760,892 C231S probably damaging Het
Rnf220 T A 4: 117,307,590 E238D probably damaging Het
Scn9a A T 2: 66,504,849 D1265E probably damaging Het
Sntb2 T A 8: 107,001,637 S406T probably damaging Het
Sos1 T C 17: 80,406,838 I1068V probably benign Het
Spg20 A G 3: 55,128,276 K519E probably damaging Het
Tlx3 A T 11: 33,203,058 F134L probably damaging Het
Trbj1-2 A T 6: 41,534,030 T10S Het
Txk A C 5: 72,735,193 L33R probably damaging Het
Ulk2 A G 11: 61,791,432 probably null Het
Usp20 T C 2: 31,010,544 S357P probably benign Het
Wac T A 18: 7,921,560 N565K possibly damaging Het
Zfp709 G T 8: 71,890,840 K704N probably damaging Het
Zfp788 C T 7: 41,649,625 Q562* probably null Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGACCTGGGATAAAGCTAGG -3'
(R):5'- CACTTCTGAGTAAAAGCGCG -3'

Sequencing Primer
(F):5'- AAGCATCAGGGACCTTGC -3'
(R):5'- AAAGCGCGTCTTTTTGTTGTTG -3'
Posted On2020-08-01