Incidental Mutation 'BB007:Usp20'
ID 642392
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms Vdu2, 1700055M05Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # BB007
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 30872291-30912667 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30900556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 357 (S357P)
Ref Sequence ENSEMBL: ENSMUSP00000099913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102849
AA Change: S357P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: S357P

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136588
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170476
AA Change: S357P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: S357P

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 C T 8: 41,250,107 (GRCm39) T739I probably benign Het
Adam23 G T 1: 63,624,586 (GRCm39) V805F possibly damaging Het
Adamts17 A T 7: 66,499,547 (GRCm39) R31S probably damaging Het
Ano4 T A 10: 89,163,138 (GRCm39) Y27F possibly damaging Het
Bbs2 A G 8: 94,796,625 (GRCm39) V675A probably damaging Het
Brca2 A G 5: 150,481,975 (GRCm39) E2839G probably damaging Het
Capn5 C T 7: 97,773,085 (GRCm39) V640I probably benign Het
Casp4 C T 9: 5,321,318 (GRCm39) T23M probably damaging Het
Cerk C T 15: 86,028,920 (GRCm39) E379K possibly damaging Het
Comp G A 8: 70,826,503 (GRCm39) G26D probably damaging Het
Cpxm1 G A 2: 130,236,982 (GRCm39) A220V possibly damaging Het
Cyp2c69 G T 19: 39,831,434 (GRCm39) P460T possibly damaging Het
Ddx23 T C 15: 98,546,504 (GRCm39) D555G probably damaging Het
E2f6 T A 12: 16,869,058 (GRCm39) I127K probably damaging Het
Efr3a T A 15: 65,733,589 (GRCm39) D716E probably benign Het
Esp16 T G 17: 39,850,868 (GRCm39) S82R possibly damaging Het
Fasn A C 11: 120,700,061 (GRCm39) S2199A probably benign Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Gas7 A G 11: 67,556,217 (GRCm39) I185M probably damaging Het
Glg1 A T 8: 111,887,367 (GRCm39) L1047I possibly damaging Het
Golga5 A G 12: 102,450,681 (GRCm39) N445D probably benign Het
Grin2c A T 11: 115,147,063 (GRCm39) H377Q probably benign Het
Hmgcs1 T C 13: 120,161,499 (GRCm39) I97T possibly damaging Het
Ifi211 T C 1: 173,733,769 (GRCm39) T131A possibly damaging Het
Ifngr1 A G 10: 19,484,931 (GRCm39) K310R probably damaging Het
Il18rap T C 1: 40,587,803 (GRCm39) V467A probably damaging Het
Itgad C A 7: 127,782,280 (GRCm39) Q239K probably benign Het
Jrkl T C 9: 13,245,506 (GRCm39) I52V possibly damaging Het
Kdm6b A T 11: 69,290,778 (GRCm39) D1630E unknown Het
Krt75 C A 15: 101,473,318 (GRCm39) *552L probably null Het
Mbd2 A G 18: 70,701,948 (GRCm39) D154G probably damaging Het
Mutyh A T 4: 116,674,153 (GRCm39) N235Y probably benign Het
Myo5b A G 18: 74,864,825 (GRCm39) T1348A probably benign Het
Ndufs7 T C 10: 80,089,619 (GRCm39) probably null Het
Nup205 T G 6: 35,171,511 (GRCm39) M458R probably damaging Het
Or1e32 A C 11: 73,705,926 (GRCm39) probably benign Het
Or1j4 G T 2: 36,740,285 (GRCm39) V76F probably damaging Het
Or2at1 A T 7: 99,416,803 (GRCm39) T145S probably benign Het
Or5b119 G A 19: 13,457,019 (GRCm39) P181L probably damaging Het
Or6b2 T A 1: 92,407,570 (GRCm39) M258L probably benign Het
Or8b101 A G 9: 38,020,264 (GRCm39) N89S possibly damaging Het
Or8k25 T A 2: 86,243,560 (GRCm39) T279S probably damaging Het
Plcl2 T G 17: 50,913,831 (GRCm39) I280S probably benign Het
Ppargc1a A T 5: 51,630,264 (GRCm39) Y618N unknown Het
Rab43 A T 6: 87,788,348 (GRCm39) I60N probably damaging Het
Rnf126 A T 10: 79,596,726 (GRCm39) C231S probably damaging Het
Rnf220 T A 4: 117,164,787 (GRCm39) E238D probably damaging Het
Scn9a A T 2: 66,335,193 (GRCm39) D1265E probably damaging Het
Sntb2 T A 8: 107,728,269 (GRCm39) S406T probably damaging Het
Sos1 T C 17: 80,714,267 (GRCm39) I1068V probably benign Het
Spart A G 3: 55,035,697 (GRCm39) K519E probably damaging Het
Tlx3 A T 11: 33,153,058 (GRCm39) F134L probably damaging Het
Trbj1-2 A T 6: 41,510,964 (GRCm39) T10S Het
Txk A C 5: 72,892,536 (GRCm39) L33R probably damaging Het
Ulk2 A G 11: 61,682,258 (GRCm39) probably null Het
Wac T A 18: 7,921,560 (GRCm39) N565K possibly damaging Het
Zfp1007 A T 5: 109,823,622 (GRCm39) C609* probably null Het
Zfp709 G T 8: 72,644,684 (GRCm39) K704N probably damaging Het
Zfp788 C T 7: 41,299,049 (GRCm39) Q562* probably null Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 30,894,962 (GRCm39) missense probably damaging 1.00
IGL01444:Usp20 APN 2 30,888,801 (GRCm39) start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 30,901,806 (GRCm39) missense probably benign 0.04
IGL01785:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL01786:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL02129:Usp20 APN 2 30,894,462 (GRCm39) missense probably benign 0.43
IGL02147:Usp20 APN 2 30,896,413 (GRCm39) missense probably damaging 1.00
IGL03396:Usp20 APN 2 30,901,729 (GRCm39) missense probably benign
BB017:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 30,907,498 (GRCm39) missense possibly damaging 0.47
R0111:Usp20 UTSW 2 30,892,624 (GRCm39) missense probably damaging 1.00
R0369:Usp20 UTSW 2 30,901,116 (GRCm39) missense probably benign 0.00
R0479:Usp20 UTSW 2 30,907,487 (GRCm39) missense probably benign 0.18
R0538:Usp20 UTSW 2 30,894,462 (GRCm39) missense probably damaging 0.99
R1023:Usp20 UTSW 2 30,897,825 (GRCm39) missense probably damaging 1.00
R1183:Usp20 UTSW 2 30,901,797 (GRCm39) missense probably benign 0.17
R1635:Usp20 UTSW 2 30,908,830 (GRCm39) missense probably benign 0.03
R2114:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2115:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2116:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2117:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2232:Usp20 UTSW 2 30,908,750 (GRCm39) missense probably benign 0.13
R2244:Usp20 UTSW 2 30,900,343 (GRCm39) missense possibly damaging 0.65
R2883:Usp20 UTSW 2 30,908,812 (GRCm39) missense probably benign
R4734:Usp20 UTSW 2 30,909,836 (GRCm39) missense probably benign 0.31
R5507:Usp20 UTSW 2 30,900,238 (GRCm39) missense probably benign
R5770:Usp20 UTSW 2 30,907,520 (GRCm39) missense probably damaging 1.00
R5862:Usp20 UTSW 2 30,896,461 (GRCm39) nonsense probably null
R6315:Usp20 UTSW 2 30,907,770 (GRCm39) missense possibly damaging 0.70
R7603:Usp20 UTSW 2 30,901,486 (GRCm39) missense probably damaging 1.00
R7887:Usp20 UTSW 2 30,910,906 (GRCm39) missense probably benign 0.34
R7930:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
R8542:Usp20 UTSW 2 30,901,636 (GRCm39) missense possibly damaging 0.94
R8965:Usp20 UTSW 2 30,901,797 (GRCm39) missense possibly damaging 0.77
R9079:Usp20 UTSW 2 30,895,120 (GRCm39) intron probably benign
R9226:Usp20 UTSW 2 30,907,412 (GRCm39) missense probably damaging 0.99
R9417:Usp20 UTSW 2 30,873,030 (GRCm39) critical splice acceptor site probably null
R9459:Usp20 UTSW 2 30,901,024 (GRCm39) missense probably damaging 0.99
Z1176:Usp20 UTSW 2 30,909,830 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCTGTCCTGTGACTCGAGC -3'
(R):5'- TTTCCAACTGAGGCCCAAGAC -3'

Sequencing Primer
(F):5'- TCCTGTGACTCGAGCAGTGAC -3'
(R):5'- CAGCCTGTGAGGAAGGCTTG -3'
Posted On 2020-08-01