Mutagenetix > Incidental Mutation

Incidental Mutation 'BB007:Nup205'

642404

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

BB007

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 35194576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 458 (M458R)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably damaging
Transcript: ENSMUST00000043815
AA Change: M405R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: M405R

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201374
AA Change: M458R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: M458R

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	T	5: 109,675,756	C609*	probably null	Het
Adam20	C	T	8: 40,797,070	T739I	probably benign	Het
Adam23	G	T	1: 63,585,427	V805F	possibly damaging	Het
Adamts17	A	T	7: 66,849,799	R31S	probably damaging	Het
Ano4	T	A	10: 89,327,276	Y27F	possibly damaging	Het
Bbs2	A	G	8: 94,069,997	V675A	probably damaging	Het
Brca2	A	G	5: 150,558,510	E2839G	probably damaging	Het
Capn5	C	T	7: 98,123,878	V640I	probably benign	Het
Casp4	C	T	9: 5,321,318	T23M	probably damaging	Het
Cerk	C	T	15: 86,144,719	E379K	possibly damaging	Het
Comp	G	A	8: 70,373,853	G26D	probably damaging	Het
Cpxm1	G	A	2: 130,395,062	A220V	possibly damaging	Het
Cyp2c69	G	T	19: 39,842,990	P460T	possibly damaging	Het
Ddx23	T	C	15: 98,648,623	D555G	probably damaging	Het
E2f6	T	A	12: 16,819,057	I127K	probably damaging	Het
Efr3a	T	A	15: 65,861,740	D716E	probably benign	Het
Esp16	T	G	17: 39,539,977	S82R	possibly damaging	Het
Fasn	A	C	11: 120,809,235	S2199A	probably benign	Het
Fscb	A	G	12: 64,472,563	S710P	unknown	Het
Gas7	A	G	11: 67,665,391	I185M	probably damaging	Het
Glg1	A	T	8: 111,160,735	L1047I	possibly damaging	Het
Golga5	A	G	12: 102,484,422	N445D	probably benign	Het
Grin2c	A	T	11: 115,256,237	H377Q	probably benign	Het
Hmgcs1	T	C	13: 119,699,963	I97T	possibly damaging	Het
Ifi211	T	C	1: 173,906,203	T131A	possibly damaging	Het
Ifngr1	A	G	10: 19,609,183	K310R	probably damaging	Het
Il18rap	T	C	1: 40,548,643	V467A	probably damaging	Het
Itgad	C	A	7: 128,183,108	Q239K	probably benign	Het
Jrkl	T	C	9: 13,245,501	I52V	possibly damaging	Het
Kdm6b	A	T	11: 69,399,952	D1630E	unknown	Het
Krt75	C	A	15: 101,564,883	*552L	probably null	Het
Mbd2	A	G	18: 70,568,877	D154G	probably damaging	Het
Mutyh	A	T	4: 116,816,956	N235Y	probably benign	Het
Myo5b	A	G	18: 74,731,754	T1348A	probably benign	Het
Ndufs7	T	C	10: 80,253,785		probably null	Het
Olfr1061	T	A	2: 86,413,216	T279S	probably damaging	Het
Olfr1416	T	A	1: 92,479,848	M258L	probably benign	Het
Olfr1475	G	A	19: 13,479,655	P181L	probably damaging	Het
Olfr350	G	T	2: 36,850,273	V76F	probably damaging	Het
Olfr392	A	C	11: 73,815,100		probably benign	Het
Olfr521	A	T	7: 99,767,596	T145S	probably benign	Het
Olfr888	A	G	9: 38,108,968	N89S	possibly damaging	Het
Plcl2	T	G	17: 50,606,803	I280S	probably benign	Het
Ppargc1a	A	T	5: 51,472,922	Y618N	unknown	Het
Rab43	A	T	6: 87,811,366	I60N	probably damaging	Het
Rnf126	A	T	10: 79,760,892	C231S	probably damaging	Het
Rnf220	T	A	4: 117,307,590	E238D	probably damaging	Het
Scn9a	A	T	2: 66,504,849	D1265E	probably damaging	Het
Sntb2	T	A	8: 107,001,637	S406T	probably damaging	Het
Sos1	T	C	17: 80,406,838	I1068V	probably benign	Het
Spg20	A	G	3: 55,128,276	K519E	probably damaging	Het
Tlx3	A	T	11: 33,203,058	F134L	probably damaging	Het
Trbj1-2	A	T	6: 41,534,030	T10S		Het
Txk	A	C	5: 72,735,193	L33R	probably damaging	Het
Ulk2	A	G	11: 61,791,432		probably null	Het
Usp20	T	C	2: 31,010,544	S357P	probably benign	Het
Wac	T	A	18: 7,921,560	N565K	possibly damaging	Het
Zfp709	G	T	8: 71,890,840	K704N	probably damaging	Het
Zfp788	C	T	7: 41,649,625	Q562*	probably null	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTGAATCTGTAGCCCTGGC -3'
(R):5'- AGTTGCCAAACATTGAGCTATG -3'

Sequencing Primer
(F):5'- CTGGCTGAGTTCACAGAAGC -3'
(R):5'- ATGGCTCATCGGTTAAGAGCACC -3'

Posted On

2020-08-01