Incidental Mutation 'R0048:Vmn1r67'
ID64245
Institutional Source Beutler Lab
Gene Symbol Vmn1r67
Ensembl Gene ENSMUSG00000046716
Gene Namevomeronasal 1 receptor 67
SynonymsV1re10
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0048 (G1)
Quality Score131
Status Validated
Chromosome7
Chromosomal Location10443331-10449202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10446866 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 19 (G19E)
Ref Sequence ENSEMBL: ENSMUSP00000060746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055964] [ENSMUST00000226237]
Predicted Effect probably damaging
Transcript: ENSMUST00000055964
AA Change: G19E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060746
Gene: ENSMUSG00000046716
AA Change: G19E

DomainStartEndE-ValueType
Pfam:V1R 34 292 4.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226237
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mroh9 G A 1: 163,062,487 T227M probably damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Olfr273 C A 4: 52,856,196 A106S probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Urah C T 7: 140,836,752 T46I probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Wdr76 C T 2: 121,535,419 probably benign Het
Wwox C A 8: 114,439,830 P20Q probably damaging Het
Other mutations in Vmn1r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Vmn1r67 APN 7 10446840 missense possibly damaging 0.96
IGL02812:Vmn1r67 APN 7 10447018 missense probably benign 0.01
IGL03121:Vmn1r67 APN 7 10447467 missense probably benign 0.00
IGL03208:Vmn1r67 APN 7 10447098 missense possibly damaging 0.94
PIT4142001:Vmn1r67 UTSW 7 10446950 missense probably benign 0.13
R0549:Vmn1r67 UTSW 7 10447714 missense probably damaging 1.00
R1595:Vmn1r67 UTSW 7 10447670 missense probably benign 0.18
R1608:Vmn1r67 UTSW 7 10446980 missense possibly damaging 0.82
R2284:Vmn1r67 UTSW 7 10447673 missense probably damaging 0.97
R3614:Vmn1r67 UTSW 7 10447429 missense probably damaging 0.98
R4399:Vmn1r67 UTSW 7 10447549 missense possibly damaging 0.89
R4542:Vmn1r67 UTSW 7 10447430 missense probably damaging 0.99
R5216:Vmn1r67 UTSW 7 10447163 missense probably benign 0.00
R5655:Vmn1r67 UTSW 7 10447388 missense probably benign 0.43
R5837:Vmn1r67 UTSW 7 10447022 missense probably benign 0.26
R6526:Vmn1r67 UTSW 7 10447671 missense probably benign 0.05
R6735:Vmn1r67 UTSW 7 10447211 missense probably damaging 1.00
R6846:Vmn1r67 UTSW 7 10446913 missense probably benign 0.04
R7086:Vmn1r67 UTSW 7 10447117 missense possibly damaging 0.93
R7227:Vmn1r67 UTSW 7 10447548 nonsense probably null
R7594:Vmn1r67 UTSW 7 10447415 missense possibly damaging 0.95
R7608:Vmn1r67 UTSW 7 10447363 missense possibly damaging 0.89
R7797:Vmn1r67 UTSW 7 10446976 missense probably benign 0.30
R8681:Vmn1r67 UTSW 7 10447201 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACCCCTCTGATTTAGCCTCAGTAGC -3'
(R):5'- GCACCCAATGTACTTTGCAGCATTC -3'

Sequencing Primer
(F):5'- GATTTAGCCTCAGTAGCTCTTCAG -3'
(R):5'- CCTTAAAGCAGGATTTCCTGTGAC -3'
Posted On2013-08-06