Incidental Mutation 'BB008:Wwp1'
ID642458
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB008
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 19650114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably benign
Transcript: ENSMUST00000035982
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108246
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108246
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,206,715 probably null Het
Aire G A 10: 78,030,296 A536V probably damaging Het
Aox4 A G 1: 58,255,486 I951M probably benign Het
Ash1l G T 3: 89,043,541 C2190F probably damaging Het
C1s1 C T 6: 124,533,400 V363M probably damaging Het
Diaph3 A T 14: 87,115,020 D48E possibly damaging Het
Dnajc13 A G 9: 104,218,564 V559A probably benign Het
Dzank1 T C 2: 144,481,694 I610V probably benign Het
F7 A G 8: 13,035,209 I412V probably benign Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gm13212 G A 4: 145,622,556 D188N possibly damaging Het
Igkv4-70 C A 6: 69,267,991 R82L probably damaging Het
Lnp1 T A 16: 56,927,918 R4* probably null Het
Lrrc3b T C 14: 15,358,018 N196S probably benign Het
Mlxip A G 5: 123,450,495 D816G probably damaging Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Myom3 A T 4: 135,789,636 H839L probably benign Het
Nebl C T 2: 17,376,622 probably null Het
Ninj1 T C 13: 49,193,956 I99T probably damaging Het
Olfr1249 T A 2: 89,630,104 I265F possibly damaging Het
Olfr167 A G 16: 19,515,508 S43P possibly damaging Het
Olfr738 A C 14: 50,414,329 M262L probably damaging Het
Olfr972 A T 9: 39,873,850 T192S possibly damaging Het
Otop1 A G 5: 38,288,020 H174R probably damaging Het
Pcdhb16 A G 18: 37,478,457 N157D possibly damaging Het
Prss44 A C 9: 110,814,678 Q130P probably damaging Het
Ptpn4 T A 1: 119,680,195 M712L probably damaging Het
Ptprh C A 7: 4,571,988 S344I probably benign Het
Rps6kl1 T C 12: 85,149,792 I33V possibly damaging Het
Scn1a T C 2: 66,317,812 S110G probably damaging Het
Sdk2 C A 11: 113,893,441 K157N possibly damaging Het
Serpina1d A T 12: 103,767,556 V163D probably damaging Het
Serpina3g T C 12: 104,239,169 S56P probably benign Het
Slc4a4 T C 5: 89,170,781 L636P probably benign Het
Slc6a1 T C 6: 114,311,902 F474S probably benign Het
Slco6d1 A G 1: 98,428,416 D235G probably damaging Het
Srgn A T 10: 62,494,984 M114K possibly damaging Het
Syne3 A T 12: 104,963,232 V243E probably damaging Het
Tcf19 A G 17: 35,514,907 F118L probably damaging Het
Tln2 A T 9: 67,258,460 probably null Het
Tnxb A G 17: 34,688,698 T1239A probably damaging Het
Traip A G 9: 107,971,042 I453M probably benign Het
Vmn1r157 C T 7: 22,761,785 A30V probably damaging Het
Vmn1r233 G A 17: 20,993,863 A275V probably benign Het
Vps13d G A 4: 145,096,284 R2976* probably null Het
Wdr75 T C 1: 45,819,635 F655L probably benign Het
Zc3h4 T C 7: 16,432,984 L747P unknown Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
BB018:Wwp1 UTSW 4 19650114 critical splice donor site probably null
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7931:Wwp1 UTSW 4 19650114 critical splice donor site probably null
R8006:Wwp1 UTSW 4 19650174 missense probably benign
R8851:Wwp1 UTSW 4 19643437 missense probably null 1.00
R8910:Wwp1 UTSW 4 19627741 missense possibly damaging 0.70
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACCGGATAAGTGACTGTTCTTAAC -3'
(R):5'- AATGTATTCCCTCTGCCAGTG -3'

Sequencing Primer
(F):5'- AACCTTGTGTCATGCATGCAG -3'
(R):5'- CCAGTGCGGAAGTGGGAC -3'
Posted On2020-08-01