Mutagenetix > Incidental Mutation

Incidental Mutation 'BB008:Flt1'

642465

Institutional Source

Beutler Lab

Gene Symbol

Flt1

Ensembl Gene

ENSMUSG00000029648

Gene Name

FMS-like tyrosine kinase 1

Synonyms

Flt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

BB008

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

147561604-147726011 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 147588572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 919 (S919P)

Ref Sequence

ENSEMBL: ENSMUSP00000031653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031653]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031653
AA Change: S919P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: S919P

Domain	Start	End	E-Value	Type
IG	38	130	1.74e-3	SMART
IG	144	225	1.49e-2	SMART
IG	238	330	2.23e-10	SMART
IG	345	426	2.43e-2	SMART
IG	440	554	2.6e-2	SMART
IGc2	569	644	1.76e-8	SMART
IGc2	674	739	6.29e-19	SMART
low complexity region	769	786	N/A	INTRINSIC
TyrKc	828	1154	9.54e-144	SMART

Meta Mutation Damage Score

0.7897

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp2	A	T	2: 91,206,715		probably null	Het
Aire	G	A	10: 78,030,296	A536V	probably damaging	Het
Aox4	A	G	1: 58,255,486	I951M	probably benign	Het
Ash1l	G	T	3: 89,043,541	C2190F	probably damaging	Het
C1s1	C	T	6: 124,533,400	V363M	probably damaging	Het
Diaph3	A	T	14: 87,115,020	D48E	possibly damaging	Het
Dnajc13	A	G	9: 104,218,564	V559A	probably benign	Het
Dzank1	T	C	2: 144,481,694	I610V	probably benign	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Gm13212	G	A	4: 145,622,556	D188N	possibly damaging	Het
Igkv4-70	C	A	6: 69,267,991	R82L	probably damaging	Het
Lnp1	T	A	16: 56,927,918	R4*	probably null	Het
Lrrc3b	T	C	14: 15,358,018	N196S	probably benign	Het
Mlxip	A	G	5: 123,450,495	D816G	probably damaging	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Myom3	A	T	4: 135,789,636	H839L	probably benign	Het
Nebl	C	T	2: 17,376,622		probably null	Het
Ninj1	T	C	13: 49,193,956	I99T	probably damaging	Het
Olfr1249	T	A	2: 89,630,104	I265F	possibly damaging	Het
Olfr167	A	G	16: 19,515,508	S43P	possibly damaging	Het
Olfr738	A	C	14: 50,414,329	M262L	probably damaging	Het
Olfr972	A	T	9: 39,873,850	T192S	possibly damaging	Het
Otop1	A	G	5: 38,288,020	H174R	probably damaging	Het
Pcdhb16	A	G	18: 37,478,457	N157D	possibly damaging	Het
Prss44	A	C	9: 110,814,678	Q130P	probably damaging	Het
Ptpn4	T	A	1: 119,680,195	M712L	probably damaging	Het
Ptprh	C	A	7: 4,571,988	S344I	probably benign	Het
Rps6kl1	T	C	12: 85,149,792	I33V	possibly damaging	Het
Scn1a	T	C	2: 66,317,812	S110G	probably damaging	Het
Sdk2	C	A	11: 113,893,441	K157N	possibly damaging	Het
Serpina1d	A	T	12: 103,767,556	V163D	probably damaging	Het
Serpina3g	T	C	12: 104,239,169	S56P	probably benign	Het
Slc4a4	T	C	5: 89,170,781	L636P	probably benign	Het
Slc6a1	T	C	6: 114,311,902	F474S	probably benign	Het
Slco6d1	A	G	1: 98,428,416	D235G	probably damaging	Het
Srgn	A	T	10: 62,494,984	M114K	possibly damaging	Het
Syne3	A	T	12: 104,963,232	V243E	probably damaging	Het
Tcf19	A	G	17: 35,514,907	F118L	probably damaging	Het
Tln2	A	T	9: 67,258,460		probably null	Het
Tnxb	A	G	17: 34,688,698	T1239A	probably damaging	Het
Traip	A	G	9: 107,971,042	I453M	probably benign	Het
Vmn1r157	C	T	7: 22,761,785	A30V	probably damaging	Het
Vmn1r233	G	A	17: 20,993,863	A275V	probably benign	Het
Vps13d	G	A	4: 145,096,284	R2976*	probably null	Het
Wdr75	T	C	1: 45,819,635	F655L	probably benign	Het
Wwp1	A	G	4: 19,650,114		probably null	Het
Zc3h4	T	C	7: 16,432,984	L747P	unknown	Het

Other mutations in Flt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Flt1	APN	5	147580300	critical splice donor site	probably null
IGL00469:Flt1	APN	5	147603605	missense	probably damaging	0.99
IGL00897:Flt1	APN	5	147589854	missense	probably benign	0.25
IGL01111:Flt1	APN	5	147578336	missense	probably damaging	1.00
IGL01154:Flt1	APN	5	147576156	missense	possibly damaging	0.63
IGL01744:Flt1	APN	5	147571461	missense	probably benign	0.01
IGL01973:Flt1	APN	5	147683889	missense	probably benign	0.01
IGL02079:Flt1	APN	5	147568831	splice site	probably benign
IGL02143:Flt1	APN	5	147578436	missense	probably benign	0.00
IGL02156:Flt1	APN	5	147681741	missense	probably damaging	0.99
IGL02345:Flt1	APN	5	147582626	missense	probably benign	0.20
IGL02548:Flt1	APN	5	147639248	missense	probably benign	0.00
IGL02631:Flt1	APN	5	147673574	nonsense	probably null
IGL02686:Flt1	APN	5	147588602	missense	probably damaging	1.00
IGL02938:Flt1	APN	5	147678299	missense	possibly damaging	0.47
IGL03057:Flt1	APN	5	147681924	nonsense	probably null
IGL03196:Flt1	APN	5	147615127	critical splice donor site	probably null
IGL03205:Flt1	APN	5	147699821	missense	probably benign	0.00
IGL03255:Flt1	APN	5	147588521	splice site	probably benign
flywheels	UTSW	5	147599646	missense	probably damaging	1.00
BB018:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
IGL02837:Flt1	UTSW	5	147655170	missense	probably benign	0.32
PIT4402001:Flt1	UTSW	5	147678239	missense	probably damaging	1.00
R0013:Flt1	UTSW	5	147571014	splice site	probably benign
R0380:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
R0448:Flt1	UTSW	5	147566394	splice site	probably benign
R0789:Flt1	UTSW	5	147639483	missense	probably damaging	1.00
R1005:Flt1	UTSW	5	147681885	missense	probably damaging	0.99
R1241:Flt1	UTSW	5	147599646	missense	probably damaging	1.00
R1302:Flt1	UTSW	5	147564240	missense	possibly damaging	0.93
R1411:Flt1	UTSW	5	147580316	missense	probably damaging	1.00
R1615:Flt1	UTSW	5	147639288	missense	probably damaging	1.00
R1634:Flt1	UTSW	5	147676430	missense	probably damaging	1.00
R1749:Flt1	UTSW	5	147655119	missense	probably benign	0.00
R1768:Flt1	UTSW	5	147672709	missense	probably damaging	1.00
R1972:Flt1	UTSW	5	147655093	splice site	probably benign
R2074:Flt1	UTSW	5	147599606	missense	possibly damaging	0.82
R2081:Flt1	UTSW	5	147639422	missense	probably damaging	1.00
R2864:Flt1	UTSW	5	147594621	missense	possibly damaging	0.68
R2865:Flt1	UTSW	5	147594621	missense	possibly damaging	0.68
R3740:Flt1	UTSW	5	147599593	missense	probably damaging	1.00
R3820:Flt1	UTSW	5	147700017	splice site	probably benign
R4089:Flt1	UTSW	5	147564241	missense	probably benign	0.03
R4299:Flt1	UTSW	5	147683907	missense	probably benign	0.00
R4570:Flt1	UTSW	5	147594613	missense	probably damaging	1.00
R4812:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4853:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4865:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4900:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4906:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4907:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4909:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5072:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5073:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5074:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5218:Flt1	UTSW	5	147681928	missense	probably damaging	1.00
R5547:Flt1	UTSW	5	147655138	missense	probably damaging	1.00
R5731:Flt1	UTSW	5	147678152	missense	probably benign	0.16
R5732:Flt1	UTSW	5	147634483	nonsense	probably null
R5804:Flt1	UTSW	5	147580437	splice site	probably null
R6107:Flt1	UTSW	5	147603593	missense	probably benign	0.15
R6440:Flt1	UTSW	5	147564305	missense	possibly damaging	0.79
R6453:Flt1	UTSW	5	147683941	missense	possibly damaging	0.80
R6539:Flt1	UTSW	5	147578376	missense	probably benign	0.27
R7068:Flt1	UTSW	5	147673634	missense	probably damaging	1.00
R7112:Flt1	UTSW	5	147603569	missense	probably damaging	1.00
R7195:Flt1	UTSW	5	147603576	missense	probably damaging	1.00
R7255:Flt1	UTSW	5	147580406	missense	probably damaging	1.00
R7347:Flt1	UTSW	5	147580381	missense	probably damaging	1.00
R7469:Flt1	UTSW	5	147603569	missense	probably damaging	1.00
R7473:Flt1	UTSW	5	147594595	missense	probably damaging	1.00
R7663:Flt1	UTSW	5	147655120	missense	probably benign
R7688:Flt1	UTSW	5	147676325	missense	probably benign
R7729:Flt1	UTSW	5	147700367	missense	probably benign	0.00
R7931:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
R8051:Flt1	UTSW	5	147582691	missense	probably benign	0.02
R8275:Flt1	UTSW	5	147678147	missense	probably damaging	0.99
R8434:Flt1	UTSW	5	147639443	missense	probably damaging	0.97
R8442:Flt1	UTSW	5	147576173	missense	probably damaging	1.00
R8756:Flt1	UTSW	5	147639414	missense	probably benign	0.07
R8855:Flt1	UTSW	5	147570872	missense	probably benign	0.00
R8855:Flt1	UTSW	5	147681650	missense	probably damaging	1.00
R9165:Flt1	UTSW	5	147615237	missense	probably damaging	0.99
R9240:Flt1	UTSW	5	147681866	missense	probably benign
R9439:Flt1	UTSW	5	147578397	missense	probably damaging	1.00
R9658:Flt1	UTSW	5	147588567	missense	probably damaging	0.97
X0064:Flt1	UTSW	5	147673613	missense	probably damaging	1.00
Z1088:Flt1	UTSW	5	147681649	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AGCCATACCTTTAGAATCTAGGC -3'
(R):5'- TAGTCTCAGGTGCACTCTCG -3'

Sequencing Primer
(F):5'- ACCTTTAGAATCTAGGCCTGGCTAG -3'
(R):5'- TGCACTCTCGGGCCCTAC -3'

Posted On

2020-08-01