Incidental Mutation 'BB008:C1s1'
ID 642468
Institutional Source Beutler Lab
Gene Symbol C1s1
Ensembl Gene ENSMUSG00000038521
Gene Name complement component 1, s subcomponent 1
Synonyms C1s
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # BB008
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124530345-124542359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124533400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 363 (V363M)
Ref Sequence ENSEMBL: ENSMUSP00000125531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160505] [ENSMUST00000162443]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000160505
AA Change: V363M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125531
Gene: ENSMUSG00000038521
AA Change: V363M

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162443
AA Change: V363M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125712
Gene: ENSMUSG00000038521
AA Change: V363M

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Meta Mutation Damage Score 0.2068 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,206,715 probably null Het
Aire G A 10: 78,030,296 A536V probably damaging Het
Aox4 A G 1: 58,255,486 I951M probably benign Het
Ash1l G T 3: 89,043,541 C2190F probably damaging Het
Diaph3 A T 14: 87,115,020 D48E possibly damaging Het
Dnajc13 A G 9: 104,218,564 V559A probably benign Het
Dzank1 T C 2: 144,481,694 I610V probably benign Het
F7 A G 8: 13,035,209 I412V probably benign Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gm13212 G A 4: 145,622,556 D188N possibly damaging Het
Igkv4-70 C A 6: 69,267,991 R82L probably damaging Het
Lnp1 T A 16: 56,927,918 R4* probably null Het
Lrrc3b T C 14: 15,358,018 N196S probably benign Het
Mlxip A G 5: 123,450,495 D816G probably damaging Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Myom3 A T 4: 135,789,636 H839L probably benign Het
Nebl C T 2: 17,376,622 probably null Het
Ninj1 T C 13: 49,193,956 I99T probably damaging Het
Olfr1249 T A 2: 89,630,104 I265F possibly damaging Het
Olfr167 A G 16: 19,515,508 S43P possibly damaging Het
Olfr738 A C 14: 50,414,329 M262L probably damaging Het
Olfr972 A T 9: 39,873,850 T192S possibly damaging Het
Otop1 A G 5: 38,288,020 H174R probably damaging Het
Pcdhb16 A G 18: 37,478,457 N157D possibly damaging Het
Prss44 A C 9: 110,814,678 Q130P probably damaging Het
Ptpn4 T A 1: 119,680,195 M712L probably damaging Het
Ptprh C A 7: 4,571,988 S344I probably benign Het
Rps6kl1 T C 12: 85,149,792 I33V possibly damaging Het
Scn1a T C 2: 66,317,812 S110G probably damaging Het
Sdk2 C A 11: 113,893,441 K157N possibly damaging Het
Serpina1d A T 12: 103,767,556 V163D probably damaging Het
Serpina3g T C 12: 104,239,169 S56P probably benign Het
Slc4a4 T C 5: 89,170,781 L636P probably benign Het
Slc6a1 T C 6: 114,311,902 F474S probably benign Het
Slco6d1 A G 1: 98,428,416 D235G probably damaging Het
Srgn A T 10: 62,494,984 M114K possibly damaging Het
Syne3 A T 12: 104,963,232 V243E probably damaging Het
Tcf19 A G 17: 35,514,907 F118L probably damaging Het
Tln2 A T 9: 67,258,460 probably null Het
Tnxb A G 17: 34,688,698 T1239A probably damaging Het
Traip A G 9: 107,971,042 I453M probably benign Het
Vmn1r157 C T 7: 22,761,785 A30V probably damaging Het
Vmn1r233 G A 17: 20,993,863 A275V probably benign Het
Vps13d G A 4: 145,096,284 R2976* probably null Het
Wdr75 T C 1: 45,819,635 F655L probably benign Het
Wwp1 A G 4: 19,650,114 probably null Het
Zc3h4 T C 7: 16,432,984 L747P unknown Het
Other mutations in C1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:C1s1 APN 6 124541334 missense probably benign 0.02
IGL02590:C1s1 APN 6 124531276 missense possibly damaging 0.89
IGL02968:C1s1 APN 6 124540351 missense probably damaging 0.99
IGL03301:C1s1 APN 6 124541324 splice site probably benign
BB018:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R0105:C1s1 UTSW 6 124541318 splice site probably benign
R0396:C1s1 UTSW 6 124533354 missense probably benign 0.03
R0759:C1s1 UTSW 6 124531437 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1396:C1s1 UTSW 6 124531051 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1627:C1s1 UTSW 6 124537480 missense probably damaging 1.00
R1855:C1s1 UTSW 6 124534356 critical splice donor site probably null
R2010:C1s1 UTSW 6 124537394 missense probably damaging 1.00
R2349:C1s1 UTSW 6 124541473 start gained probably benign
R4544:C1s1 UTSW 6 124531540 missense probably benign 0.31
R4661:C1s1 UTSW 6 124536490 missense probably benign 0.22
R5383:C1s1 UTSW 6 124534401 missense probably damaging 1.00
R5687:C1s1 UTSW 6 124540950 missense probably benign 0.01
R5846:C1s1 UTSW 6 124540953 missense possibly damaging 0.93
R6289:C1s1 UTSW 6 124531176 missense probably damaging 0.99
R6410:C1s1 UTSW 6 124531158 missense probably damaging 1.00
R6983:C1s1 UTSW 6 124540896 missense possibly damaging 0.93
R7931:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R8141:C1s1 UTSW 6 124531362 missense probably damaging 1.00
R8341:C1s1 UTSW 6 124531156 missense probably damaging 1.00
R8399:C1s1 UTSW 6 124535293 missense probably benign 0.00
R8926:C1s1 UTSW 6 124533366 missense probably damaging 1.00
R8926:C1s1 UTSW 6 124536363 missense possibly damaging 0.95
R9008:C1s1 UTSW 6 124532540 critical splice donor site probably null
R9147:C1s1 UTSW 6 124540799 missense probably damaging 1.00
R9148:C1s1 UTSW 6 124540799 missense probably damaging 1.00
R9153:C1s1 UTSW 6 124540947 missense possibly damaging 0.78
R9177:C1s1 UTSW 6 124531403 missense probably damaging 0.98
RF029:C1s1 UTSW 6 124541351 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGTCCTTAGACTAAGCCAAAAGG -3'
(R):5'- CAAGAGCCATCTGCATTGGC -3'

Sequencing Primer
(F):5'- GCCAAAAGGATGACAATATCTTCTC -3'
(R):5'- ATTGGCAGCTCTCAGAGGG -3'
Posted On 2020-08-01