Incidental Mutation 'BB008:Sdk2'
ID 642480
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 4632412F08Rik, 5330435L01Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # BB008
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 113667200-113957855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 113784267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 157 (K157N)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]
AlphaFold Q6V4S5
Predicted Effect possibly damaging
Transcript: ENSMUST00000041627
AA Change: K157N

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: K157N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141943
AA Change: K157N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: K157N

DomainStartEndE-ValueType
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 889 1.96e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,037,060 (GRCm39) probably null Het
Aire G A 10: 77,866,130 (GRCm39) A536V probably damaging Het
Aox4 A G 1: 58,294,645 (GRCm39) I951M probably benign Het
Ash1l G T 3: 88,950,848 (GRCm39) C2190F probably damaging Het
C1s1 C T 6: 124,510,359 (GRCm39) V363M probably damaging Het
Diaph3 A T 14: 87,352,456 (GRCm39) D48E possibly damaging Het
Dnajc13 A G 9: 104,095,763 (GRCm39) V559A probably benign Het
Dzank1 T C 2: 144,323,614 (GRCm39) I610V probably benign Het
F7 A G 8: 13,085,209 (GRCm39) I412V probably benign Het
Flt1 A G 5: 147,525,382 (GRCm39) S919P probably damaging Het
Igkv4-70 C A 6: 69,244,975 (GRCm39) R82L probably damaging Het
Lnp1 T A 16: 56,748,281 (GRCm39) R4* probably null Het
Lrrc3b T C 14: 15,358,018 (GRCm38) N196S probably benign Het
Mlxip A G 5: 123,588,558 (GRCm39) D816G probably damaging Het
Myh7 C T 14: 55,221,119 (GRCm39) E935K possibly damaging Het
Myom3 A T 4: 135,516,947 (GRCm39) H839L probably benign Het
Nebl C T 2: 17,381,433 (GRCm39) probably null Het
Ninj1 T C 13: 49,347,432 (GRCm39) I99T probably damaging Het
Or11g1 A C 14: 50,651,786 (GRCm39) M262L probably damaging Het
Or2l5 A G 16: 19,334,258 (GRCm39) S43P possibly damaging Het
Or4a76 T A 2: 89,460,448 (GRCm39) I265F possibly damaging Het
Or8g55 A T 9: 39,785,146 (GRCm39) T192S possibly damaging Het
Otop1 A G 5: 38,445,364 (GRCm39) H174R probably damaging Het
Pcdhb16 A G 18: 37,611,510 (GRCm39) N157D possibly damaging Het
Prss44 A C 9: 110,643,746 (GRCm39) Q130P probably damaging Het
Ptpn4 T A 1: 119,607,925 (GRCm39) M712L probably damaging Het
Ptprh C A 7: 4,574,987 (GRCm39) S344I probably benign Het
Rps6kl1 T C 12: 85,196,566 (GRCm39) I33V possibly damaging Het
Scn1a T C 2: 66,148,156 (GRCm39) S110G probably damaging Het
Serpina1d A T 12: 103,733,815 (GRCm39) V163D probably damaging Het
Serpina3g T C 12: 104,205,428 (GRCm39) S56P probably benign Het
Slc4a4 T C 5: 89,318,640 (GRCm39) L636P probably benign Het
Slc6a1 T C 6: 114,288,863 (GRCm39) F474S probably benign Het
Slco6d1 A G 1: 98,356,141 (GRCm39) D235G probably damaging Het
Srgn A T 10: 62,330,763 (GRCm39) M114K possibly damaging Het
Syne3 A T 12: 104,929,491 (GRCm39) V243E probably damaging Het
Tcf19 A G 17: 35,825,804 (GRCm39) F118L probably damaging Het
Tln2 A T 9: 67,165,742 (GRCm39) probably null Het
Tnxb A G 17: 34,907,672 (GRCm39) T1239A probably damaging Het
Traip A G 9: 107,848,241 (GRCm39) I453M probably benign Het
Vmn1r157 C T 7: 22,461,210 (GRCm39) A30V probably damaging Het
Vmn1r233 G A 17: 21,214,125 (GRCm39) A275V probably benign Het
Vps13d G A 4: 144,822,854 (GRCm39) R2976* probably null Het
Wdr75 T C 1: 45,858,795 (GRCm39) F655L probably benign Het
Wwp1 A G 4: 19,650,114 (GRCm39) probably null Het
Zc3h4 T C 7: 16,166,909 (GRCm39) L747P unknown Het
Zfp268 G A 4: 145,349,126 (GRCm39) D188N possibly damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113,745,210 (GRCm39) missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113,721,668 (GRCm39) missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113,733,906 (GRCm39) missense probably benign
IGL01316:Sdk2 APN 11 113,758,791 (GRCm39) missense probably benign 0.09
IGL01614:Sdk2 APN 11 113,684,684 (GRCm39) missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113,729,358 (GRCm39) missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113,729,320 (GRCm39) missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113,725,656 (GRCm39) missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113,725,639 (GRCm39) splice site probably benign
IGL02543:Sdk2 APN 11 113,759,747 (GRCm39) missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113,742,668 (GRCm39) missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113,712,452 (GRCm39) missense probably benign 0.00
IGL03122:Sdk2 APN 11 113,732,894 (GRCm39) missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113,741,810 (GRCm39) missense probably benign 0.19
IGL03222:Sdk2 APN 11 113,729,257 (GRCm39) missense probably benign 0.01
IGL03310:Sdk2 APN 11 113,684,151 (GRCm39) missense possibly damaging 0.77
Curtailed UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
Trimmed UTSW 11 113,747,522 (GRCm39) nonsense probably null
ANU05:Sdk2 UTSW 11 113,733,906 (GRCm39) missense probably benign
BB018:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113,717,912 (GRCm39) missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0386:Sdk2 UTSW 11 113,784,290 (GRCm39) missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113,720,793 (GRCm39) missense probably benign 0.04
R0409:Sdk2 UTSW 11 113,741,717 (GRCm39) splice site probably benign
R0416:Sdk2 UTSW 11 113,694,029 (GRCm39) missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113,682,292 (GRCm39) missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113,671,836 (GRCm39) missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113,685,746 (GRCm39) splice site probably null
R0711:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0717:Sdk2 UTSW 11 113,723,152 (GRCm39) missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R0831:Sdk2 UTSW 11 113,723,084 (GRCm39) missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113,712,241 (GRCm39) missense probably benign 0.00
R0865:Sdk2 UTSW 11 113,741,748 (GRCm39) missense probably benign 0.12
R0930:Sdk2 UTSW 11 113,729,271 (GRCm39) missense probably benign 0.01
R0964:Sdk2 UTSW 11 113,697,243 (GRCm39) splice site probably benign
R1051:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1052:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1054:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1055:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1077:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1079:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1115:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1186:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1187:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1337:Sdk2 UTSW 11 113,723,157 (GRCm39) missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1433:Sdk2 UTSW 11 113,685,871 (GRCm39) missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113,784,401 (GRCm39) splice site probably benign
R1514:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1529:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1596:Sdk2 UTSW 11 113,729,435 (GRCm39) splice site probably benign
R1680:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1680:Sdk2 UTSW 11 113,682,262 (GRCm39) missense possibly damaging 0.47
R1770:Sdk2 UTSW 11 113,684,567 (GRCm39) missense probably benign 0.05
R1858:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1866:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1874:Sdk2 UTSW 11 113,725,782 (GRCm39) missense probably benign 0.00
R1899:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1905:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1907:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1913:Sdk2 UTSW 11 113,747,552 (GRCm39) missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113,671,843 (GRCm39) nonsense probably null
R2055:Sdk2 UTSW 11 113,741,780 (GRCm39) missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113,745,158 (GRCm39) missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113,833,948 (GRCm39) missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113,721,620 (GRCm39) missense probably benign 0.44
R3720:Sdk2 UTSW 11 113,691,070 (GRCm39) missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113,747,522 (GRCm39) nonsense probably null
R4037:Sdk2 UTSW 11 113,685,881 (GRCm39) missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113,757,815 (GRCm39) splice site probably null
R4717:Sdk2 UTSW 11 113,745,195 (GRCm39) missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113,717,880 (GRCm39) missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113,712,208 (GRCm39) nonsense probably null
R4924:Sdk2 UTSW 11 113,748,584 (GRCm39) missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113,684,587 (GRCm39) missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113,741,808 (GRCm39) missense probably benign 0.01
R5239:Sdk2 UTSW 11 113,758,859 (GRCm39) missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113,715,912 (GRCm39) missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113,757,857 (GRCm39) missense probably benign 0.31
R5535:Sdk2 UTSW 11 113,833,984 (GRCm39) missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113,742,540 (GRCm39) missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113,724,005 (GRCm39) missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113,759,778 (GRCm39) missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113,717,942 (GRCm39) missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113,745,099 (GRCm39) missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113,725,810 (GRCm39) missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113,742,708 (GRCm39) missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113,720,885 (GRCm39) missense probably benign 0.00
R5953:Sdk2 UTSW 11 113,684,570 (GRCm39) missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113,834,080 (GRCm39) missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113,720,889 (GRCm39) missense probably benign 0.00
R6116:Sdk2 UTSW 11 113,745,190 (GRCm39) missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113,684,581 (GRCm39) missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R6383:Sdk2 UTSW 11 113,723,091 (GRCm39) missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113,758,760 (GRCm39) missense probably benign 0.43
R6835:Sdk2 UTSW 11 113,720,874 (GRCm39) missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113,671,755 (GRCm39) missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113,793,946 (GRCm39) missense probably benign 0.03
R7000:Sdk2 UTSW 11 113,693,995 (GRCm39) missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113,725,731 (GRCm39) missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113,733,516 (GRCm39) nonsense probably null
R7177:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113,729,315 (GRCm39) missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113,758,909 (GRCm39) splice site probably null
R7504:Sdk2 UTSW 11 113,758,793 (GRCm39) missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113,764,039 (GRCm39) missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113,684,563 (GRCm39) missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113,764,027 (GRCm39) missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113,750,764 (GRCm39) missense probably benign 0.18
R8052:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113,717,915 (GRCm39) missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113,742,539 (GRCm39) missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113,763,683 (GRCm39) missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113,729,542 (GRCm39) missense probably benign
R8715:Sdk2 UTSW 11 113,671,728 (GRCm39) missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113,763,978 (GRCm39) nonsense probably null
R9136:Sdk2 UTSW 11 113,697,203 (GRCm39) missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113,714,226 (GRCm39) missense probably benign 0.18
R9300:Sdk2 UTSW 11 113,715,856 (GRCm39) missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113,725,757 (GRCm39) missense probably benign 0.00
R9450:Sdk2 UTSW 11 113,697,105 (GRCm39) missense probably benign
R9462:Sdk2 UTSW 11 113,760,744 (GRCm39) missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113,691,061 (GRCm39) missense probably benign 0.05
R9678:Sdk2 UTSW 11 113,685,789 (GRCm39) nonsense probably null
RF002:Sdk2 UTSW 11 113,776,078 (GRCm39) missense probably benign 0.00
V1662:Sdk2 UTSW 11 113,725,734 (GRCm39) missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113,742,662 (GRCm39) missense probably damaging 0.97
Z1176:Sdk2 UTSW 11 113,730,148 (GRCm39) missense probably benign 0.41
Z1177:Sdk2 UTSW 11 113,750,782 (GRCm39) missense probably benign
Z1177:Sdk2 UTSW 11 113,730,146 (GRCm39) missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113,729,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGCACGCATATTCCAAGC -3'
(R):5'- GATGGATTGCCCTTCTGACC -3'

Sequencing Primer
(F):5'- AACTTCTCTCACCACTCAGGGG -3'
(R):5'- GATTGCCCTTCTGACCTCTGC -3'
Posted On 2020-08-01