Incidental Mutation 'BB009:Ubb'
ID 642541
Institutional Source Beutler Lab
Gene Symbol Ubb
Ensembl Gene ENSMUSG00000019505
Gene Name ubiquitin B
Synonyms Ubb2
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.345) question?
Stock # BB009
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 62551171-62553213 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 62552785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 214 (Q214*)
Ref Sequence ENSEMBL: ENSMUSP00000019649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019649] [ENSMUST00000136938]
AlphaFold P0CG49
Predicted Effect probably null
Transcript: ENSMUST00000019649
AA Change: Q214*
SMART Domains Protein: ENSMUSP00000019649
Gene: ENSMUSG00000019505
AA Change: Q214*

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136938
AA Change: Q214*
SMART Domains Protein: ENSMUSP00000117361
Gene: ENSMUSG00000019505
AA Change: Q214*

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of four direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. Pseudogenes of this gene are located on chromosomes 3 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Targeted disruption of this gene results in progressive degeneration of hypothalamic neurons accompanied by impaired hypothalamic control of energy balance and adult-onset obesity. Both genders are infertile due to a failure of germ cells to progress through meiosis I and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,573,180 R666G unknown Het
Adam21 T A 12: 81,560,164 N275Y probably damaging Het
Arhgap24 A T 5: 102,845,969 probably benign Het
Arhgef1 C T 7: 24,919,710 L459F probably damaging Het
Bbx A T 16: 50,210,443 probably null Het
Blk C T 14: 63,373,559 G445S possibly damaging Het
Brca1 T C 11: 101,540,017 E33G possibly damaging Het
Cacna1s T G 1: 136,084,359 L513R probably damaging Het
Cnn3 T A 3: 121,451,429 M98K probably benign Het
Cttnbp2 T A 6: 18,427,533 L716F probably damaging Het
Dlgap1 A T 17: 70,516,238 R73W probably damaging Het
Dnajc4 A G 19: 6,988,270 L182P probably damaging Het
Dock2 T C 11: 34,267,998 M1191V probably benign Het
Fam13a C T 6: 58,983,888 probably null Het
Fbn2 C T 18: 58,020,483 G2569E possibly damaging Het
Fes T C 7: 80,379,872 I623V probably damaging Het
Fyco1 A C 9: 123,828,990 L707R possibly damaging Het
Gadd45b T A 10: 80,930,335 V7E possibly damaging Het
Gm12169 C A 11: 46,535,539 P158T probably benign Het
Gm19410 T A 8: 35,795,599 C897S probably damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Hk1 A G 10: 62,315,520 L31P probably damaging Het
Hoxa4 T G 6: 52,190,417 K261N probably damaging Het
Hrh4 T A 18: 13,015,812 L77* probably null Het
Igf1r A T 7: 68,212,054 I1121F possibly damaging Het
Igkv16-104 A T 6: 68,425,794 I24L probably benign Het
Itk A T 11: 46,340,692 W346R probably benign Het
Kdm2a A G 19: 4,319,156 S1144P probably damaging Het
Krt86 A T 15: 101,476,592 S289C probably damaging Het
Lonrf1 T C 8: 36,222,916 I663V probably benign Het
Lrp2 T G 2: 69,426,027 I4590L probably benign Het
Lrrc8d C T 5: 105,813,025 R434C probably damaging Het
Maneal T C 4: 124,861,845 Y108C probably damaging Het
Myh8 G A 11: 67,294,604 V894I probably benign Het
Ncam2 T G 16: 81,615,820 L732R probably damaging Het
Nsun4 A T 4: 116,044,800 D156E probably damaging Het
Olfr111 T C 17: 37,530,184 I69T probably benign Het
Olfr136 A T 17: 38,335,255 I33L probably benign Het
Olfr1459 A T 19: 13,145,981 M226K probably benign Het
Olfr382 A C 11: 73,517,157 L14R probably damaging Het
Olfr419 T C 1: 174,250,694 I78V probably benign Het
Olfr798 C A 10: 129,625,225 V279F probably damaging Het
P2rx7 G A 5: 122,644,182 V37I probably benign Het
Pcdh15 A G 10: 74,645,527 R235G probably benign Het
Pcdhga1 T C 18: 37,663,460 S506P probably damaging Het
Pira2 A T 7: 3,842,436 probably null Het
Plch1 A G 3: 63,701,981 V935A probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prpf8 A G 11: 75,492,597 D607G possibly damaging Het
Ptdss1 T C 13: 66,966,432 W215R probably damaging Het
Ptpn9 C A 9: 57,036,616 P258Q possibly damaging Het
Rfpl4b A G 10: 38,821,350 V85A possibly damaging Het
Sacs C A 14: 61,204,878 Q1458K probably damaging Het
Scfd2 A T 5: 74,531,550 S24T probably benign Het
Siae A G 9: 37,633,684 D325G probably benign Het
Slc22a23 C A 13: 34,182,977 A683S probably damaging Het
Slc44a3 A T 3: 121,512,360 I244N possibly damaging Het
Srrm2 T A 17: 23,818,527 S1382T probably benign Het
Tfap2c A G 2: 172,551,786 Y207C probably damaging Het
Tnc T C 4: 64,008,620 I890V probably benign Het
Trim30a A T 7: 104,429,338 I177N probably benign Het
Tshz2 T A 2: 169,886,331 M949K possibly damaging Het
Ttn T G 2: 76,725,186 T30492P probably damaging Het
Ulk2 A G 11: 61,808,090 S423P probably benign Het
Vmn1r237 C A 17: 21,314,463 D149E probably benign Het
Zbtb24 A G 10: 41,451,508 D130G probably benign Het
Zfp689 C A 7: 127,444,351 G369V probably damaging Het
Zg16 A G 7: 127,050,405 F128S probably damaging Het
Zmym1 T G 4: 127,050,785 N203T possibly damaging Het
Other mutations in Ubb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03302:Ubb APN 11 62552417 missense probably damaging 1.00
BB019:Ubb UTSW 11 62552785 nonsense probably null
R1120:Ubb UTSW 11 62552183 missense possibly damaging 0.94
R6223:Ubb UTSW 11 62552525 missense possibly damaging 0.91
R6753:Ubb UTSW 11 62551527 splice site probably null
R7932:Ubb UTSW 11 62552785 nonsense probably null
R8201:Ubb UTSW 11 62552227 missense probably benign 0.00
R8932:Ubb UTSW 11 62552153 missense probably damaging 1.00
R9492:Ubb UTSW 11 62552158 missense probably damaging 1.00
R9705:Ubb UTSW 11 62552549 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGCATGCAGATCTTCGTGAAG -3'
(R):5'- AGAGAGTGCGGCCATCTTCTAG -3'

Sequencing Primer
(F):5'- TCTTCGTGAAGACCCTGACTGG -3'
(R):5'- TGCTTGCCGGCAAAGATCAG -3'
Posted On 2020-08-01