Incidental Mutation 'R0050:H1foo'
ID64256
Institutional Source Beutler Lab
Gene Symbol H1foo
Ensembl Gene ENSMUSG00000042279
Gene NameH1 histone family, member O, oocyte-specific
SynonymsH1oo
MMRRC Submission 038344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0050 (G1)
Quality Score174
Status Validated
Chromosome6
Chromosomal Location115944938-115950236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115947768 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 78 (K78N)
Ref Sequence ENSEMBL: ENSMUSP00000123797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037831] [ENSMUST00000161617] [ENSMUST00000161969] [ENSMUST00000162084] [ENSMUST00000205177]
Predicted Effect probably damaging
Transcript: ENSMUST00000037831
AA Change: K78N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036951
Gene: ENSMUSG00000042279
AA Change: K78N

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
H15 43 110 8.84e-11 SMART
low complexity region 123 146 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161617
AA Change: K78N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125701
Gene: ENSMUSG00000042279
AA Change: K78N

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
H15 43 110 8.84e-11 SMART
low complexity region 123 146 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161969
AA Change: K78N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123797
Gene: ENSMUSG00000042279
AA Change: K78N

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
H15 43 110 8.84e-11 SMART
low complexity region 123 146 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162084
Predicted Effect probably benign
Transcript: ENSMUST00000205177
SMART Domains Protein: ENSMUSP00000144958
Gene: ENSMUSG00000042279

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Meta Mutation Damage Score 0.1230 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein encoded is a replication-independent histone that is a member of the histone H1 family. This gene contains introns, unlike most histone genes and the encoded protein is expressed only in oocytes. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit no detectable abnormalities. Oocytes develop normally and no defects in fertility or litter sizes are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C T 11: 110,145,591 C564Y probably damaging Het
Adamts2 T C 11: 50,775,395 V406A probably damaging Het
Ankar T A 1: 72,656,164 E1093D probably damaging Het
Arhgef38 C A 3: 133,132,196 D75Y probably damaging Het
Atg4b T A 1: 93,787,718 probably benign Het
Cadm2 A G 16: 66,953,266 probably benign Het
Ces2c T A 8: 104,848,199 M96K probably benign Het
Dmrt3 C A 19: 25,622,589 P266H probably damaging Het
Dock9 A G 14: 121,607,225 V1124A probably benign Het
Edem1 T C 6: 108,828,848 F37L possibly damaging Het
Ermp1 C A 19: 29,628,784 A190S probably damaging Het
Gm10267 T A 18: 44,156,453 probably benign Het
Gm11492 T C 11: 87,567,346 L182S probably damaging Het
Golga2 T A 2: 32,292,127 V29D probably damaging Het
Gprc6a T A 10: 51,615,389 M755L probably damaging Het
Lama3 T A 18: 12,404,103 H268Q probably damaging Het
Lrriq1 A G 10: 103,068,931 V1614A probably damaging Het
Oaz2 A G 9: 65,687,802 E61G probably damaging Het
Pear1 G T 3: 87,755,987 Y441* probably null Het
Pkhd1l1 A T 15: 44,573,807 T3493S possibly damaging Het
Plekhg5 T C 4: 152,108,088 probably null Het
Ppp3cb A G 14: 20,531,752 V65A possibly damaging Het
Rheb A T 5: 24,817,834 probably benign Het
Ros1 G A 10: 52,101,803 T1449M probably damaging Het
Slc6a12 T C 6: 121,360,419 probably benign Het
Stx2 A G 5: 128,999,508 probably null Het
Tnxb T A 17: 34,673,325 D764E probably damaging Het
Trmt2a A T 16: 18,250,843 E234D probably damaging Het
Other mutations in H1foo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:H1foo APN 6 115947627 unclassified probably benign
IGL00864:H1foo APN 6 115948626 missense probably damaging 0.99
R0050:H1foo UTSW 6 115947768 missense probably damaging 1.00
R0056:H1foo UTSW 6 115946973 unclassified probably benign
R0081:H1foo UTSW 6 115949981 missense probably benign
R0559:H1foo UTSW 6 115947799 missense probably damaging 1.00
R1302:H1foo UTSW 6 115947649 nonsense probably null
R1476:H1foo UTSW 6 115947740 missense possibly damaging 0.61
R1824:H1foo UTSW 6 115948758 missense probably null 0.97
R3778:H1foo UTSW 6 115949747 critical splice donor site probably null
R3928:H1foo UTSW 6 115948796 missense probably benign 0.12
R3929:H1foo UTSW 6 115948796 missense probably benign 0.12
R6316:H1foo UTSW 6 115948915 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGCAGCCTAGCAGCTAGTGATG -3'
(R):5'- AGCAGCGTGTACTAAGGGTCTGAG -3'

Sequencing Primer
(F):5'- TGCTCTGCCCCACCAAAG -3'
(R):5'- GGCCTCCCCCTCCTTCTC -3'
Posted On2013-08-06